Incidental Mutation 'R3808:D3Ertd254e'
ID275023
Institutional Source Beutler Lab
Gene Symbol D3Ertd254e
Ensembl Gene ENSMUSG00000033883
Gene NameDNA segment, Chr 3, ERATO Doi 254, expressed
Synonyms
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36151017-36170342 bp(+) (GRCm38)
Type of Mutationsplice site (2969 bp from exon)
DNA Base Change (assembly) T to G at 36165643 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165956] [ENSMUST00000197653] [ENSMUST00000205077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165956
AA Change: F604C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131779
Gene: ENSMUSG00000033883
AA Change: F604C

DomainStartEndE-ValueType
KRAB 3 63 2.91e-34 SMART
ZnF_C2H2 342 364 1.08e-1 SMART
ZnF_C2H2 395 417 1.56e-2 SMART
ZnF_C2H2 423 445 3.11e-2 SMART
ZnF_C2H2 451 473 5.9e-3 SMART
ZnF_C2H2 479 501 1.82e-3 SMART
ZnF_C2H2 507 529 5.21e-4 SMART
ZnF_C2H2 535 557 1.84e-4 SMART
ZnF_C2H2 563 585 1.95e-3 SMART
ZnF_C2H2 591 613 2.05e-2 SMART
ZnF_C2H2 619 641 1.6e-4 SMART
ZnF_C2H2 647 669 5.21e-4 SMART
ZnF_C2H2 675 697 1.69e-3 SMART
ZnF_C2H2 703 725 2.61e-4 SMART
ZnF_C2H2 731 753 1.12e-3 SMART
ZnF_C2H2 759 779 3.85e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197653
AA Change: F605C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142829
Gene: ENSMUSG00000033883
AA Change: F605C

DomainStartEndE-ValueType
KRAB 4 64 1.2e-36 SMART
ZnF_C2H2 343 365 4.4e-4 SMART
ZnF_C2H2 396 418 6.7e-5 SMART
ZnF_C2H2 424 446 1.3e-4 SMART
ZnF_C2H2 452 474 2.5e-5 SMART
ZnF_C2H2 480 502 7.9e-6 SMART
ZnF_C2H2 508 530 2.2e-6 SMART
ZnF_C2H2 536 558 7.7e-7 SMART
ZnF_C2H2 564 586 8e-6 SMART
ZnF_C2H2 592 614 8.9e-5 SMART
ZnF_C2H2 620 642 6.6e-7 SMART
ZnF_C2H2 648 670 2.2e-6 SMART
ZnF_C2H2 676 698 7.1e-6 SMART
ZnF_C2H2 704 726 1.1e-6 SMART
ZnF_C2H2 732 754 4.8e-6 SMART
ZnF_C2H2 760 780 1.6e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205077
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in D3Ertd254e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:D3Ertd254e APN 3 36164580 missense possibly damaging 0.86
IGL02089:D3Ertd254e APN 3 36164728 missense possibly damaging 0.53
IGL02162:D3Ertd254e APN 3 36164061 missense probably benign 0.18
R0243:D3Ertd254e UTSW 3 36165154 missense possibly damaging 0.47
R0512:D3Ertd254e UTSW 3 36166113 missense probably damaging 0.96
R0722:D3Ertd254e UTSW 3 36165069 missense probably benign 0.35
R0762:D3Ertd254e UTSW 3 36165867 missense possibly damaging 0.92
R0792:D3Ertd254e UTSW 3 36164562 missense probably benign 0.01
R0894:D3Ertd254e UTSW 3 36164786 nonsense probably null
R1731:D3Ertd254e UTSW 3 36164471 missense probably benign 0.18
R2098:D3Ertd254e UTSW 3 36166140 missense probably benign
R2099:D3Ertd254e UTSW 3 36164212 missense possibly damaging 0.86
R3709:D3Ertd254e UTSW 3 36159576 missense possibly damaging 0.71
R4035:D3Ertd254e UTSW 3 36164840 missense possibly damaging 0.53
R4288:D3Ertd254e UTSW 3 36159598 missense possibly damaging 0.71
R4289:D3Ertd254e UTSW 3 36159598 missense possibly damaging 0.71
R4959:D3Ertd254e UTSW 3 36164136 missense possibly damaging 0.91
R4973:D3Ertd254e UTSW 3 36164136 missense possibly damaging 0.91
R5102:D3Ertd254e UTSW 3 36162665 missense possibly damaging 0.73
R5462:D3Ertd254e UTSW 3 36165820 missense possibly damaging 0.95
R5548:D3Ertd254e UTSW 3 36165491 missense possibly damaging 0.90
R5782:D3Ertd254e UTSW 3 36164979 missense possibly damaging 0.73
R6153:D3Ertd254e UTSW 3 36165154 missense possibly damaging 0.47
R6225:D3Ertd254e UTSW 3 36166203 missense probably benign 0.18
R6602:D3Ertd254e UTSW 3 36164855 missense possibly damaging 0.86
R6785:D3Ertd254e UTSW 3 36165452 nonsense probably null
R7513:D3Ertd254e UTSW 3 36164643 missense possibly damaging 0.53
R7846:D3Ertd254e UTSW 3 36165589 missense probably benign 0.43
R8120:D3Ertd254e UTSW 3 36164491 missense possibly damaging 0.96
R8265:D3Ertd254e UTSW 3 36159528 start gained probably benign
R8415:D3Ertd254e UTSW 3 36165033 missense probably damaging 0.98
X0021:D3Ertd254e UTSW 3 36164191 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TTCATACGGGAGAAAAGCCCT -3'
(R):5'- CTCCTGTGTGAATTCTCTGGT -3'

Sequencing Primer
(F):5'- GCCCTACCATTGTAAAGACTGTGG -3'
(R):5'- CACAGTCTTGACACTTGTAGGGC -3'
Posted On2015-04-02