Incidental Mutation 'R3808:Eif2b4'
ID275028
Institutional Source Beutler Lab
Gene Symbol Eif2b4
Ensembl Gene ENSMUSG00000029145
Gene Nameeukaryotic translation initiation factor 2B, subunit 4 delta
SynonymsEif2b
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31187558-31193430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31191168 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 88 (S88P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031029] [ENSMUST00000077693] [ENSMUST00000114603] [ENSMUST00000166769] [ENSMUST00000200730] [ENSMUST00000201154] [ENSMUST00000202758] [ENSMUST00000202124] [ENSMUST00000201535] [ENSMUST00000201679]
Predicted Effect probably benign
Transcript: ENSMUST00000031029
SMART Domains Protein: ENSMUSP00000031029
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 105 3.42e-24 SMART
B41 113 274 4.05e-2 SMART
low complexity region 324 342 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077693
AA Change: S192P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076875
Gene: ENSMUSG00000029145
AA Change: S192P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 29 60 N/A INTRINSIC
coiled coil region 93 122 N/A INTRINSIC
Pfam:IF-2B 219 510 3.4e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114603
AA Change: S212P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110250
Gene: ENSMUSG00000029145
AA Change: S212P

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114605
AA Change: S234P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110252
Gene: ENSMUSG00000029145
AA Change: S234P

DomainStartEndE-ValueType
coiled coil region 71 102 N/A INTRINSIC
coiled coil region 135 164 N/A INTRINSIC
Pfam:IF-2B 261 552 2.3e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166769
AA Change: S212P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130880
Gene: ENSMUSG00000029145
AA Change: S212P

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200724
AA Change: S88P

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000200730
SMART Domains Protein: ENSMUSP00000144504
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 87 2.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200741
Predicted Effect probably benign
Transcript: ENSMUST00000200929
AA Change: S11P

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000200977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200983
Predicted Effect probably benign
Transcript: ENSMUST00000201154
SMART Domains Protein: ENSMUSP00000143802
Gene: ENSMUSG00000029145

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201343
Predicted Effect probably benign
Transcript: ENSMUST00000202758
AA Change: S234P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144361
Gene: ENSMUSG00000029145
AA Change: S234P

DomainStartEndE-ValueType
coiled coil region 71 102 N/A INTRINSIC
coiled coil region 135 164 N/A INTRINSIC
Pfam:IF-2B 261 552 2.3e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202323
Predicted Effect probably benign
Transcript: ENSMUST00000202124
SMART Domains Protein: ENSMUSP00000144168
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 31 6e-8 BLAST
PDB:3LUI|C 1 31 4e-9 PDB
low complexity region 41 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201535
SMART Domains Protein: ENSMUSP00000144643
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 23 3e-7 BLAST
PDB:3LUI|C 1 23 3e-8 PDB
low complexity region 24 35 N/A INTRINSIC
Blast:B41 36 169 5e-92 BLAST
PDB:4GXB|A 36 169 4e-90 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201679
SMART Domains Protein: ENSMUSP00000144688
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Pfam:PX 6 67 2.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic initiation factor 2B (EIF2B), which is necessary for protein synthesis, is a GTP exchange factor composed of five different subunits. The protein encoded by this gene is the fourth, or delta, subunit. Defects in this gene are a cause of leukoencephalopathy with vanishing white matter (VWM) and ovarioleukodystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Eif2b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Eif2b4 APN 5 31187767 missense probably benign 0.02
IGL02525:Eif2b4 APN 5 31189618 missense probably damaging 0.99
IGL03178:Eif2b4 APN 5 31187653 missense probably damaging 1.00
IGL03267:Eif2b4 APN 5 31192659 missense possibly damaging 0.90
IGL03379:Eif2b4 APN 5 31190011 splice site probably benign
IGL03397:Eif2b4 APN 5 31187653 missense probably damaging 1.00
R0346:Eif2b4 UTSW 5 31188108 splice site probably benign
R1549:Eif2b4 UTSW 5 31192921 missense possibly damaging 0.72
R1636:Eif2b4 UTSW 5 31192266 splice site probably null
R1753:Eif2b4 UTSW 5 31192940 missense probably benign 0.00
R2263:Eif2b4 UTSW 5 31192574 splice site probably benign
R2317:Eif2b4 UTSW 5 31191576 splice site probably null
R3809:Eif2b4 UTSW 5 31191168 missense possibly damaging 0.95
R4746:Eif2b4 UTSW 5 31187653 missense probably damaging 1.00
R4752:Eif2b4 UTSW 5 31191231 nonsense probably null
R4798:Eif2b4 UTSW 5 31189520 intron probably benign
R4895:Eif2b4 UTSW 5 31192954 missense probably benign 0.00
R4936:Eif2b4 UTSW 5 31192897 missense probably benign 0.00
R5588:Eif2b4 UTSW 5 31192173 nonsense probably null
R5660:Eif2b4 UTSW 5 31191156 missense probably benign 0.00
R6363:Eif2b4 UTSW 5 31191239 missense probably damaging 0.99
R6653:Eif2b4 UTSW 5 31192207 missense possibly damaging 0.89
R6750:Eif2b4 UTSW 5 31189960 missense probably damaging 0.99
R7062:Eif2b4 UTSW 5 31192831 missense probably benign
R7221:Eif2b4 UTSW 5 31187787 missense possibly damaging 0.55
R7360:Eif2b4 UTSW 5 31191375 missense probably benign 0.08
R7779:Eif2b4 UTSW 5 31190654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGAGTACCTCTTGGCCC -3'
(R):5'- CTCCTTAGAAAGCCAGATCGAC -3'

Sequencing Primer
(F):5'- CCTGCCCCTCATGAGAAGG -3'
(R):5'- TGGTACCTGGAGAATTGCCC -3'
Posted On2015-04-02