Incidental Mutation 'R3808:Atp2b1'
ID275047
Institutional Source Beutler Lab
Gene Symbol Atp2b1
Ensembl Gene ENSMUSG00000019943
Gene NameATPase, Ca++ transporting, plasma membrane 1
SynonymsPMCA1, 2810442I22Rik, E130111D10Rik
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location98914406-99026143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99003148 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 613 (K613E)
Ref Sequence ENSEMBL: ENSMUSP00000020107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020107]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020107
AA Change: K613E

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020107
Gene: ENSMUSG00000019943
AA Change: K613E

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.8e-3 SMART
low complexity region 138 156 N/A INTRINSIC
Pfam:E1-E2_ATPase 157 312 1.5e-28 PFAM
Pfam:E1-E2_ATPase 348 464 1.4e-13 PFAM
Pfam:HAD 472 806 6.9e-22 PFAM
Pfam:Cation_ATPase 492 614 8.8e-17 PFAM
Pfam:Hydrolase 605 809 5.8e-14 PFAM
Pfam:Hydrolase_3 764 842 7.2e-7 PFAM
transmembrane domain 855 877 N/A INTRINSIC
Pfam:Cation_ATPase_C 879 1061 1.2e-47 PFAM
low complexity region 1079 1092 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1103 1155 7.5e-31 PFAM
low complexity region 1176 1188 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000219090
AA Change: K32E
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 1. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Atp2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Atp2b1 APN 10 99015020 missense possibly damaging 0.84
IGL00972:Atp2b1 APN 10 99015044 missense probably damaging 1.00
IGL00977:Atp2b1 APN 10 98986975 missense possibly damaging 0.88
IGL01154:Atp2b1 APN 10 98996888 missense probably damaging 1.00
IGL03073:Atp2b1 APN 10 98999851 missense probably damaging 1.00
IGL03081:Atp2b1 APN 10 98994813 splice site probably benign
PIT4453001:Atp2b1 UTSW 10 99016978 missense probably benign 0.00
R0157:Atp2b1 UTSW 10 98999947 missense probably damaging 0.99
R0200:Atp2b1 UTSW 10 98979814 nonsense probably null
R0899:Atp2b1 UTSW 10 99017031 critical splice donor site probably null
R0981:Atp2b1 UTSW 10 99015629 missense probably damaging 1.00
R1163:Atp2b1 UTSW 10 98979851 missense possibly damaging 0.91
R1569:Atp2b1 UTSW 10 98987326 missense probably benign 0.02
R1572:Atp2b1 UTSW 10 98994675 missense probably benign 0.10
R1574:Atp2b1 UTSW 10 98996948 missense probably damaging 1.00
R1574:Atp2b1 UTSW 10 98996948 missense probably damaging 1.00
R1721:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1782:Atp2b1 UTSW 10 99003201 missense probably benign 0.01
R1840:Atp2b1 UTSW 10 99022929 missense probably benign 0.00
R1867:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1868:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1944:Atp2b1 UTSW 10 99022931 missense probably damaging 0.97
R1984:Atp2b1 UTSW 10 99014492 missense possibly damaging 0.95
R2055:Atp2b1 UTSW 10 99014559 missense probably damaging 1.00
R2325:Atp2b1 UTSW 10 99018895 nonsense probably null
R2399:Atp2b1 UTSW 10 98999923 missense probably benign 0.02
R2876:Atp2b1 UTSW 10 98999745 missense probably damaging 0.96
R3762:Atp2b1 UTSW 10 99009489 missense probably damaging 1.00
R3776:Atp2b1 UTSW 10 98979869 frame shift probably null
R3978:Atp2b1 UTSW 10 98996933 splice site probably null
R4391:Atp2b1 UTSW 10 99003214 missense probably benign 0.00
R4825:Atp2b1 UTSW 10 99009564 missense probably damaging 1.00
R5755:Atp2b1 UTSW 10 99003170 missense probably damaging 1.00
R5755:Atp2b1 UTSW 10 98994809 critical splice donor site probably null
R6018:Atp2b1 UTSW 10 99010760 missense probably damaging 1.00
R6179:Atp2b1 UTSW 10 99022829 missense probably damaging 1.00
R6455:Atp2b1 UTSW 10 99016980 missense possibly damaging 0.76
R6496:Atp2b1 UTSW 10 99003337 missense probably damaging 0.98
R6786:Atp2b1 UTSW 10 99016959 missense probably damaging 1.00
R6814:Atp2b1 UTSW 10 99023015 missense possibly damaging 0.87
R7034:Atp2b1 UTSW 10 98987310 missense probably damaging 1.00
R7036:Atp2b1 UTSW 10 98987310 missense probably damaging 1.00
R7079:Atp2b1 UTSW 10 99018733 missense probably benign 0.01
R7216:Atp2b1 UTSW 10 98986977 missense probably benign 0.30
R7510:Atp2b1 UTSW 10 98993896 missense probably benign 0.01
R7562:Atp2b1 UTSW 10 99022805 splice site probably null
R7651:Atp2b1 UTSW 10 99016968 missense probably damaging 0.99
R7739:Atp2b1 UTSW 10 99001365 missense probably benign 0.01
R8005:Atp2b1 UTSW 10 98994799 missense probably damaging 1.00
R8111:Atp2b1 UTSW 10 98996924 missense possibly damaging 0.95
Z1177:Atp2b1 UTSW 10 99018848 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGAGGTGGCTGGTTAAGAAC -3'
(R):5'- AACCGCGATACACGTAAGGC -3'

Sequencing Primer
(F):5'- TTAAGAACCGGAACTAAGAGCG -3'
(R):5'- TACACGTAAGGCCGGTGAC -3'
Posted On2015-04-02