Incidental Mutation 'R3808:Rdh16f1'
ID275049
Institutional Source Beutler Lab
Gene Symbol Rdh16f1
Ensembl Gene ENSMUSG00000099009
Gene NameRDH16 family member 1
SynonymsGm28046
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127759787-127792694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127788700 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 136 (V136M)
Ref Sequence ENSEMBL: ENSMUSP00000116574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052652] [ENSMUST00000128247]
Predicted Effect probably damaging
Transcript: ENSMUST00000052652
AA Change: V136M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057732
Gene: ENSMUSG00000056148
AA Change: V136M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 220 3.1e-41 PFAM
Pfam:DUF1776 43 303 5.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128133
Predicted Effect probably damaging
Transcript: ENSMUST00000128247
AA Change: V136M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116574
Gene: ENSMUSG00000099009
AA Change: V136M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 195 1.7e-23 PFAM
Pfam:DUF1776 43 303 3.3e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Rdh16f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Rdh16f1 APN 10 127759975 missense probably benign 0.00
R0445:Rdh16f1 UTSW 10 127790867 missense probably benign 0.18
R1623:Rdh16f1 UTSW 10 127790853 missense probably benign 0.00
R2336:Rdh16f1 UTSW 10 127788755 missense probably benign 0.08
R3808:Rdh16f1 UTSW 10 127788699 missense probably benign 0.03
R4544:Rdh16f1 UTSW 10 127790837 missense probably benign 0.13
R4745:Rdh16f1 UTSW 10 127790816 missense probably benign 0.03
R5005:Rdh16f1 UTSW 10 127788677 missense probably benign 0.14
R5832:Rdh16f1 UTSW 10 127788749 missense probably damaging 0.99
R6923:Rdh16f1 UTSW 10 127788868 critical splice donor site probably null
R6927:Rdh16f1 UTSW 10 127788692 missense probably benign 0.28
R7008:Rdh16f1 UTSW 10 127790906 missense probably benign 0.06
R8458:Rdh16f1 UTSW 10 127788845 missense probably damaging 1.00
Z1088:Rdh16f1 UTSW 10 127788833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGTCACAGTGTGCTTACC -3'
(R):5'- CCGATGATGTGACTTAAAGAGTGG -3'

Sequencing Primer
(F):5'- CACAGTGTGCTTACCTTATTGAATG -3'
(R):5'- CTGCCCTTCCAGTACCTGAGG -3'
Posted On2015-04-02