Incidental Mutation 'R3808:Kcnj12'
ID275050
Institutional Source Beutler Lab
Gene Symbol Kcnj12
Ensembl Gene ENSMUSG00000042529
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 12
SynonymsIRK2, MB-IRK2, Kir2.2
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61022564-61071131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61070277 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 467 (N467S)
Ref Sequence ENSEMBL: ENSMUSP00000041696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041944] [ENSMUST00000089184] [ENSMUST00000108717]
Predicted Effect probably benign
Transcript: ENSMUST00000041944
AA Change: N467S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000041696
Gene: ENSMUSG00000042529
AA Change: N467S

DomainStartEndE-ValueType
Pfam:IRK_N 104 148 1.3e-27 PFAM
Pfam:IRK 149 476 2.5e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089184
AA Change: N365S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086588
Gene: ENSMUSG00000042529
AA Change: N365S

DomainStartEndE-ValueType
Pfam:IRK_N 2 46 1.2e-31 PFAM
Pfam:IRK 47 381 5.4e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108717
AA Change: N365S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104357
Gene: ENSMUSG00000042529
AA Change: N365S

DomainStartEndE-ValueType
Pfam:IRK_N 2 46 1.2e-31 PFAM
Pfam:IRK 47 381 5.4e-174 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inwardly rectifying K+ channel which may be blocked by divalent cations. This protein is thought to be one of multiple inwardly rectifying channels which contribute to the cardiac inward rectifier current (IK1). The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are viable and fertile with no detected abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Kcnj12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02340:Kcnj12 APN 11 61069493 missense probably benign 0.00
R0377:Kcnj12 UTSW 11 61069396 missense probably benign
R1358:Kcnj12 UTSW 11 61069887 missense probably benign 0.08
R1691:Kcnj12 UTSW 11 61070277 missense possibly damaging 0.61
R1835:Kcnj12 UTSW 11 61069557 missense possibly damaging 0.86
R3809:Kcnj12 UTSW 11 61070277 missense probably benign 0.01
R5330:Kcnj12 UTSW 11 61070186 missense probably benign 0.06
R5331:Kcnj12 UTSW 11 61070186 missense probably benign 0.06
R5777:Kcnj12 UTSW 11 61070451 missense possibly damaging 0.88
R6065:Kcnj12 UTSW 11 61069877 missense probably damaging 1.00
R6525:Kcnj12 UTSW 11 61069571 missense probably damaging 1.00
R7715:Kcnj12 UTSW 11 61066952 critical splice donor site probably null
R7969:Kcnj12 UTSW 11 61069604 nonsense probably null
R8071:Kcnj12 UTSW 11 61069999 missense probably damaging 1.00
R8517:Kcnj12 UTSW 11 61069373 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGACGACTTTGAGATTGTGGTC -3'
(R):5'- AAATCTCCGACTCCCGTCTG -3'

Sequencing Primer
(F):5'- CATCCTGGAGGGCATGGTAG -3'
(R):5'- CGTCTGTAGGGCCGTTCAAG -3'
Posted On2015-04-02