Incidental Mutation 'R3808:Aldh3a2'
ID275051
Institutional Source Beutler Lab
Gene Symbol Aldh3a2
Ensembl Gene ENSMUSG00000010025
Gene Namealdehyde dehydrogenase family 3, subfamily A2
SynonymsAhd3-r, FALDH, Ahd-3r, Aldh4, Aldh4-r, Ahd-3, Ahd3
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R3808 (G1)
Quality Score206
Status Not validated
Chromosome11
Chromosomal Location61223417-61267464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 61258797 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 248 (L248M)
Ref Sequence ENSEMBL: ENSMUSP00000104355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066277] [ENSMUST00000074127] [ENSMUST00000108715]
Predicted Effect probably damaging
Transcript: ENSMUST00000066277
AA Change: L248M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067767
Gene: ENSMUSG00000010025
AA Change: L248M

DomainStartEndE-ValueType
Pfam:Aldedh 1 424 3.8e-91 PFAM
Pfam:LuxC 82 385 3.3e-8 PFAM
transmembrane domain 463 480 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074127
AA Change: L248M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073764
Gene: ENSMUSG00000010025
AA Change: L248M

DomainStartEndE-ValueType
Pfam:Aldedh 2 424 5.9e-93 PFAM
Pfam:LuxC 78 385 5.9e-9 PFAM
transmembrane domain 463 480 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108715
AA Change: L248M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104355
Gene: ENSMUSG00000010025
AA Change: L248M

DomainStartEndE-ValueType
Pfam:Aldedh 2 424 4e-93 PFAM
Pfam:LuxC 78 385 8.5e-9 PFAM
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147291
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde dehydrogenase isozymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This gene product catalyzes the oxidation of long-chain aliphatic aldehydes to fatty acid. Mutations in the gene cause Sjogren-Larsson syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit impaired long-chain base metabolism, hyperproliferation of keratinocytes, widened intercellular spaces in the basal layer of the epidermis, and delayed barrier recovery after stratum corneum perturbation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Aldh3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Aldh3a2 APN 11 61262256 missense probably damaging 1.00
IGL01374:Aldh3a2 APN 11 61249002 missense probably benign 0.01
IGL01514:Aldh3a2 APN 11 61253798 unclassified probably benign
IGL01633:Aldh3a2 APN 11 61248905 missense probably benign 0.38
IGL03153:Aldh3a2 APN 11 61258839 missense probably damaging 0.99
R0095:Aldh3a2 UTSW 11 61250948 missense probably damaging 1.00
R0126:Aldh3a2 UTSW 11 61224558 missense probably benign 0.04
R0164:Aldh3a2 UTSW 11 61248888 missense probably benign 0.23
R0164:Aldh3a2 UTSW 11 61248888 missense probably benign 0.23
R0646:Aldh3a2 UTSW 11 61253715 missense probably damaging 0.97
R0699:Aldh3a2 UTSW 11 61262322 missense probably benign 0.01
R1398:Aldh3a2 UTSW 11 61256736 splice site probably null
R1443:Aldh3a2 UTSW 11 61264307 missense probably damaging 1.00
R1454:Aldh3a2 UTSW 11 61265102 missense probably benign 0.00
R1551:Aldh3a2 UTSW 11 61253644 missense probably benign 0.01
R1557:Aldh3a2 UTSW 11 61249059 missense probably damaging 1.00
R1701:Aldh3a2 UTSW 11 61256772 missense probably damaging 1.00
R4871:Aldh3a2 UTSW 11 61262239 nonsense probably null
R5304:Aldh3a2 UTSW 11 61253712 missense probably damaging 0.99
R6318:Aldh3a2 UTSW 11 61262419 nonsense probably null
R6759:Aldh3a2 UTSW 11 61265262 missense probably benign 0.00
R6768:Aldh3a2 UTSW 11 61253710 missense probably benign 0.01
R7939:Aldh3a2 UTSW 11 61224598 missense probably benign 0.00
Z1176:Aldh3a2 UTSW 11 61264283 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAATGCAGTCACACGTGTG -3'
(R):5'- TCCATTGGAAGACATTAAAATGGAAA -3'

Sequencing Primer
(F):5'- ACACGTGTGACTGGGGTTGTC -3'
(R):5'- AGCACTCTTGGTTAAGAAGCTGC -3'
Posted On2015-04-02