Incidental Mutation 'R3808:Eftud2'
ID275055
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Nameelongation factor Tu GTP binding domain containing 2
Synonyms116kDa, Snrp116, U5-116kD
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102838473-102880985 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 102841463 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021302] [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000107072] [ENSMUST00000107073] [ENSMUST00000173679]
Predicted Effect probably benign
Transcript: ENSMUST00000021302
SMART Domains Protein: ENSMUSP00000021302
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021306
AA Change: W733R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929
AA Change: W733R

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107060
AA Change: W732R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929
AA Change: W732R

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107072
SMART Domains Protein: ENSMUSP00000102687
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107073
SMART Domains Protein: ENSMUSP00000102688
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132543
SMART Domains Protein: ENSMUSP00000133732
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFG_IV 1 65 2.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143323
Predicted Effect probably null
Transcript: ENSMUST00000172611
SMART Domains Protein: ENSMUSP00000134316
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 85 98 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173679
AA Change: W723R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929
AA Change: W723R

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102865563 splice site probably benign
IGL01765:Eftud2 APN 11 102839256 missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102869127 missense probably benign 0.08
IGL02161:Eftud2 APN 11 102854876 splice site probably benign
IGL02165:Eftud2 APN 11 102851747 splice site probably benign
IGL02218:Eftud2 APN 11 102870213 missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102851754 splice site probably null
IGL02664:Eftud2 APN 11 102841712 missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102846614 missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102870256 splice site probably benign
IGL02870:Eftud2 APN 11 102862626 missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102870183 missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102868617 missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102864725 missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102864801 splice site probably benign
R0463:Eftud2 UTSW 11 102864771 missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102844222 missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102846620 missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102849184 missense probably benign
R1079:Eftud2 UTSW 11 102840044 nonsense probably null
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1220:Eftud2 UTSW 11 102851747 splice site probably benign
R1438:Eftud2 UTSW 11 102860042 missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102839440 missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102854771 splice site probably benign
R2270:Eftud2 UTSW 11 102864781 missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102844180 missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3892:Eftud2 UTSW 11 102846187 missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102860110 missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102839416 splice site probably null
R4794:Eftud2 UTSW 11 102870177 missense probably benign 0.14
R4841:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102867844 critical splice donor site probably null
R5208:Eftud2 UTSW 11 102841185 missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102840057 missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102864780 missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102838623 nonsense probably null
R7604:Eftud2 UTSW 11 102848012 missense possibly damaging 0.87
R7886:Eftud2 UTSW 11 102840108 missense probably damaging 1.00
R8017:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8019:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8139:Eftud2 UTSW 11 102867859 missense probably benign 0.04
R8431:Eftud2 UTSW 11 102846236 missense probably benign 0.08
R8545:Eftud2 UTSW 11 102840271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTCGTCTTAGCAGGCAG -3'
(R):5'- GTTCACACTATGGCGTCTTTGC -3'

Sequencing Primer
(F):5'- CGTCTTAGCAGGCAGTGTTAG -3'
(R):5'- GCCTGGTCTCCTGACACC -3'
Posted On2015-04-02