Incidental Mutation 'R3808:Arhgap5'
ID275058
Institutional Source Beutler Lab
Gene Symbol Arhgap5
Ensembl Gene ENSMUSG00000035133
Gene NameRho GTPase activating protein 5
Synonymsp190B, p190-B
MMRRC Submission 040765-MU
Accession Numbers

Genbank: NM_009706; MGI: 1332637

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location52503972-52571975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52567187 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 192 (E192G)
Ref Sequence ENSEMBL: ENSMUSP00000151267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110725] [ENSMUST00000217820] [ENSMUST00000219443]
Predicted Effect probably benign
Transcript: ENSMUST00000110725
AA Change: E1454G

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106353
Gene: ENSMUSG00000035133
AA Change: E1454G

DomainStartEndE-ValueType
Pfam:Ras 142 248 5.3e-7 PFAM
FF 269 325 6.03e-12 SMART
FF 367 420 4.61e-8 SMART
FF 427 482 2.22e-10 SMART
FF 483 537 3.89e-6 SMART
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1224 1247 N/A INTRINSIC
RhoGAP 1273 1447 1.03e-73 SMART
low complexity region 1479 1496 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217820
AA Change: E192G

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218869
Predicted Effect probably benign
Transcript: ENSMUST00000219443
AA Change: E1454G

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype Strain: 2179998
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes die at birth, are 30% smaller, do not inflate their lungs, and show a small thymus, abnormal adipocyte differentiation and brain defects in the corpus callosum, anterior commissure and lateral ventricles. Mutant MEFs show impaired adipogenesis but undergo myogenesis in response to IGF-1. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Arhgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Arhgap5 APN 12 52517281 missense probably damaging 0.98
IGL00823:Arhgap5 APN 12 52518742 missense possibly damaging 0.84
IGL01161:Arhgap5 APN 12 52516860 missense probably damaging 1.00
IGL01360:Arhgap5 APN 12 52518240 missense probably damaging 1.00
IGL01910:Arhgap5 APN 12 52516861 missense probably benign 0.33
IGL02417:Arhgap5 APN 12 52518353 missense probably damaging 0.99
IGL02448:Arhgap5 APN 12 52562340 missense probably damaging 0.97
IGL02813:Arhgap5 APN 12 52516965 missense probably benign 0.20
IGL03398:Arhgap5 APN 12 52517311 missense probably damaging 0.99
Decline UTSW 12 52516582 nonsense probably null
Pass UTSW 12 52516507 missense possibly damaging 0.82
3-1:Arhgap5 UTSW 12 52518882 missense possibly damaging 0.54
R0039:Arhgap5 UTSW 12 52518735 nonsense probably null
R0088:Arhgap5 UTSW 12 52516548 missense probably damaging 1.00
R0104:Arhgap5 UTSW 12 52516717 missense probably damaging 1.00
R0111:Arhgap5 UTSW 12 52559960 splice site probably benign
R0356:Arhgap5 UTSW 12 52516308 missense probably damaging 1.00
R0616:Arhgap5 UTSW 12 52517065 missense possibly damaging 0.79
R0707:Arhgap5 UTSW 12 52518168 missense probably damaging 1.00
R0718:Arhgap5 UTSW 12 52516507 missense possibly damaging 0.82
R0849:Arhgap5 UTSW 12 52519623 missense probably benign 0.01
R0975:Arhgap5 UTSW 12 52517144 missense possibly damaging 0.61
R1326:Arhgap5 UTSW 12 52518370 missense possibly damaging 0.80
R1421:Arhgap5 UTSW 12 52516848 missense probably damaging 1.00
R1422:Arhgap5 UTSW 12 52519514 missense probably damaging 1.00
R1625:Arhgap5 UTSW 12 52517376 missense probably benign
R1711:Arhgap5 UTSW 12 52519345 missense probably damaging 1.00
R1970:Arhgap5 UTSW 12 52542593 missense probably damaging 1.00
R2004:Arhgap5 UTSW 12 52518034 missense probably benign 0.05
R2356:Arhgap5 UTSW 12 52519147 missense probably benign 0.00
R3792:Arhgap5 UTSW 12 52519888 missense probably benign 0.21
R4458:Arhgap5 UTSW 12 52517957 missense probably benign
R4703:Arhgap5 UTSW 12 52517583 missense probably damaging 0.99
R4736:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4737:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4740:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4768:Arhgap5 UTSW 12 52557492 missense probably damaging 1.00
R4806:Arhgap5 UTSW 12 52518703 missense probably damaging 0.99
R4817:Arhgap5 UTSW 12 52519209 missense possibly damaging 0.71
R5586:Arhgap5 UTSW 12 52519912 missense possibly damaging 0.95
R5681:Arhgap5 UTSW 12 52519779 missense probably benign 0.21
R5683:Arhgap5 UTSW 12 52519586 missense probably benign
R5911:Arhgap5 UTSW 12 52518742 missense possibly damaging 0.84
R6448:Arhgap5 UTSW 12 52517663 missense probably benign 0.11
R6887:Arhgap5 UTSW 12 52519144 missense probably benign
R6988:Arhgap5 UTSW 12 52518125 missense possibly damaging 0.94
R7009:Arhgap5 UTSW 12 52519639 missense probably benign 0.03
R7013:Arhgap5 UTSW 12 52518326 missense probably benign 0.05
R7239:Arhgap5 UTSW 12 52517376 missense probably benign
R7310:Arhgap5 UTSW 12 52542487 critical splice acceptor site probably null
R7339:Arhgap5 UTSW 12 52517698 missense possibly damaging 0.64
R7375:Arhgap5 UTSW 12 52516582 nonsense probably null
R7421:Arhgap5 UTSW 12 52518000 missense probably benign 0.42
R7442:Arhgap5 UTSW 12 52516956 missense probably benign 0.25
R7842:Arhgap5 UTSW 12 52518697 missense possibly damaging 0.78
R8079:Arhgap5 UTSW 12 52567205 missense probably benign
R8241:Arhgap5 UTSW 12 52518315 missense probably benign 0.00
R8419:Arhgap5 UTSW 12 52518789 missense probably damaging 1.00
X0018:Arhgap5 UTSW 12 52518397 missense probably damaging 1.00
Z1176:Arhgap5 UTSW 12 52518463 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCATGAATGGAAAACTAGCTTTGAG -3'
(R):5'- AACCCCTGAAACATGCATGTCTAG -3'

Sequencing Primer
(F):5'- CCCGTTTTATAATTTCAGGGTTAGTC -3'
(R):5'- AATTTCAGGCCATCTGCAATC -3'
Posted On2015-04-02