Mutagenetix > Incidental Mutation

Incidental Mutation 'R3808:Cntnap3'

275063

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

040765-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R3808 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64781804 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 527 (V527A)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: V527A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: V527A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Aldh3a2	G	T	11: 61,258,797	L248M	probably damaging	Het
Als2	A	G	1: 59,170,450	S1458P	probably benign	Het
Arhgap5	A	G	12: 52,567,187	E192G	possibly damaging	Het
Atg2a	A	G	19: 6,252,816	K1019R	possibly damaging	Het
Atp2b1	A	G	10: 99,003,148	K613E	possibly damaging	Het
Carm1	T	C	9: 21,586,962	C421R	probably damaging	Het
Cdh17	A	T	4: 11,795,671	Y417F	probably damaging	Het
Cers1	A	G	8: 70,330,010	D10G	possibly damaging	Het
Clptm1l	A	C	13: 73,612,454	M319L	probably benign	Het
Creb3l2	A	G	6: 37,355,690	S290P	probably damaging	Het
D3Ertd254e	T	G	3: 36,165,643		probably null	Het
Dock4	T	G	12: 40,672,810	V305G	probably damaging	Het
Dtl	A	C	1: 191,548,354	L356R	probably damaging	Het
Eftud2	A	T	11: 102,841,463		probably null	Het
Eif2b4	A	G	5: 31,191,168	S88P	possibly damaging	Het
Fat4	T	G	3: 38,982,438	V3413G	possibly damaging	Het
Fgfr2	T	C	7: 130,199,848	M218V	probably benign	Het
Grin2b	A	G	6: 135,923,271	L204P	probably damaging	Het
Kcnj12	A	G	11: 61,070,277	N467S	probably benign	Het
Klhdc3	T	A	17: 46,677,932	N111Y	possibly damaging	Het
Lin9	A	G	1: 180,659,111	I81V	probably null	Het
Lrp2	T	C	2: 69,501,548	D1621G	probably damaging	Het
Lrp4	T	A	2: 91,476,702	D389E	probably damaging	Het
Med15	C	T	16: 17,655,734		probably benign	Het
Nbea	T	C	3: 55,717,848	N2274S	probably benign	Het
Nr3c2	G	A	8: 76,908,714	G148D	probably damaging	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Olfr127	T	C	17: 37,903,573	V9A	probably benign	Het
Olfr982	A	T	9: 40,074,309	M5L	probably benign	Het
Paxip1	A	G	5: 27,772,029		probably benign	Het
Pfas	T	C	11: 68,989,953		probably benign	Het
Plin3	C	A	17: 56,286,275	A96S	probably damaging	Het
Pnck	T	A	X: 73,656,944	I288F	probably damaging	Het
Ppp4c	C	T	7: 126,787,327	G166D	probably damaging	Het
Prss43	A	T	9: 110,827,772	R115S	probably damaging	Het
Rassf2	T	C	2: 131,998,260		probably null	Het
Rdh16f1	T	A	10: 127,788,699	D135E	probably benign	Het
Rdh16f1	G	A	10: 127,788,700	V136M	probably damaging	Het
Rgs12	A	G	5: 35,032,354	E702G	probably damaging	Het
Rnf213	A	G	11: 119,479,558	K4728E	probably damaging	Het
Ros1	T	G	10: 52,120,848	T1243P	probably benign	Het
Sall1	G	A	8: 89,031,473	Q668*	probably null	Het
Sbf2	C	A	7: 110,489,280	*45L	probably null	Het
Serpina3j	A	T	12: 104,319,827	I414F	probably benign	Het
Sh2d3c	T	C	2: 32,746,096	Y159H	probably damaging	Het
Slamf1	A	G	1: 171,798,177	D307G	probably null	Het
Slc22a13	T	C	9: 119,196,077	T178A	probably benign	Het
Smchd1	A	T	17: 71,429,541	L588H	probably damaging	Het
Svs1	C	T	6: 48,987,994	P312L	possibly damaging	Het
Trim12a	G	A	7: 104,306,994	A113V	probably benign	Het
Vil1	T	C	1: 74,427,613	V654A	probably benign	Het
Vmn1r202	T	C	13: 22,501,900	T116A	possibly damaging	Het
Zfp607a	G	A	7: 27,879,401	R632H	probably benign	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAAAAGTGTCTTTCTAATCTCCAC -3'
(R):5'- CTGATAGAACTGTGCACTAAACCC -3'

Sequencing Primer
(F):5'- CTCCACTGTAAATGTGACTATGC -3'
(R):5'- ACTGTGCACTAAACCCGTCTGG -3'

Posted On

2015-04-02