Incidental Mutation 'R3808:Cntnap3'
ID275063
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Namecontactin associated protein-like 3
Synonyms
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location64736182-64903955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64781804 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 527 (V527A)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: V527A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: V527A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64738665 missense probably benign 0.31
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAAAAGTGTCTTTCTAATCTCCAC -3'
(R):5'- CTGATAGAACTGTGCACTAAACCC -3'

Sequencing Primer
(F):5'- CTCCACTGTAAATGTGACTATGC -3'
(R):5'- ACTGTGCACTAAACCCGTCTGG -3'
Posted On2015-04-02