Mutagenetix > Incidental Mutations

Incidental Mutation 'R3808:Clptm1l'

275064

Institutional Source

Beutler Lab

Gene Symbol

Clptm1l

Ensembl Gene

ENSMUSG00000021610

Gene Name

CLPTM1-like

Synonyms

C130052I12Rik

MMRRC Submission

040765-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3808 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73604006-73620605 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 73612454 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 319 (M319L)

Ref Sequence

ENSEMBL: ENSMUSP00000022102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022102]

Predicted Effect

probably benign
Transcript: ENSMUST00000022102
AA Change: M319L

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: M319L

Domain	Start	End	E-Value	Type
Pfam:CLPTM1	10	423	3.2e-134	PFAM
transmembrane domain	428	450	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221417

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222343

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Aldh3a2	G	T	11: 61,258,797	L248M	probably damaging	Het
Als2	A	G	1: 59,170,450	S1458P	probably benign	Het
Arhgap5	A	G	12: 52,567,187	E192G	possibly damaging	Het
Atg2a	A	G	19: 6,252,816	K1019R	possibly damaging	Het
Atp2b1	A	G	10: 99,003,148	K613E	possibly damaging	Het
Carm1	T	C	9: 21,586,962	C421R	probably damaging	Het
Cdh17	A	T	4: 11,795,671	Y417F	probably damaging	Het
Cers1	A	G	8: 70,330,010	D10G	possibly damaging	Het
Cntnap3	A	G	13: 64,781,804	V527A	probably damaging	Het
Creb3l2	A	G	6: 37,355,690	S290P	probably damaging	Het
D3Ertd254e	T	G	3: 36,165,643		probably null	Het
Dock4	T	G	12: 40,672,810	V305G	probably damaging	Het
Dtl	A	C	1: 191,548,354	L356R	probably damaging	Het
Eftud2	A	T	11: 102,841,463		probably null	Het
Eif2b4	A	G	5: 31,191,168	S88P	possibly damaging	Het
Fat4	T	G	3: 38,982,438	V3413G	possibly damaging	Het
Fgfr2	T	C	7: 130,199,848	M218V	probably benign	Het
Grin2b	A	G	6: 135,923,271	L204P	probably damaging	Het
Kcnj12	A	G	11: 61,070,277	N467S	probably benign	Het
Klhdc3	T	A	17: 46,677,932	N111Y	possibly damaging	Het
Lin9	A	G	1: 180,659,111	I81V	probably null	Het
Lrp2	T	C	2: 69,501,548	D1621G	probably damaging	Het
Lrp4	T	A	2: 91,476,702	D389E	probably damaging	Het
Med15	C	T	16: 17,655,734		probably benign	Het
Nbea	T	C	3: 55,717,848	N2274S	probably benign	Het
Nr3c2	G	A	8: 76,908,714	G148D	probably damaging	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Olfr127	T	C	17: 37,903,573	V9A	probably benign	Het
Olfr982	A	T	9: 40,074,309	M5L	probably benign	Het
Paxip1	A	G	5: 27,772,029		probably benign	Het
Pfas	T	C	11: 68,989,953		probably benign	Het
Plin3	C	A	17: 56,286,275	A96S	probably damaging	Het
Pnck	T	A	X: 73,656,944	I288F	probably damaging	Het
Ppp4c	C	T	7: 126,787,327	G166D	probably damaging	Het
Prss43	A	T	9: 110,827,772	R115S	probably damaging	Het
Rassf2	T	C	2: 131,998,260		probably null	Het
Rdh16f1	T	A	10: 127,788,699	D135E	probably benign	Het
Rdh16f1	G	A	10: 127,788,700	V136M	probably damaging	Het
Rgs12	A	G	5: 35,032,354	E702G	probably damaging	Het
Rnf213	A	G	11: 119,479,558	K4728E	probably damaging	Het
Ros1	T	G	10: 52,120,848	T1243P	probably benign	Het
Sall1	G	A	8: 89,031,473	Q668*	probably null	Het
Sbf2	C	A	7: 110,489,280	*45L	probably null	Het
Serpina3j	A	T	12: 104,319,827	I414F	probably benign	Het
Sh2d3c	T	C	2: 32,746,096	Y159H	probably damaging	Het
Slamf1	A	G	1: 171,798,177	D307G	probably null	Het
Slc22a13	T	C	9: 119,196,077	T178A	probably benign	Het
Smchd1	A	T	17: 71,429,541	L588H	probably damaging	Het
Svs1	C	T	6: 48,987,994	P312L	possibly damaging	Het
Trim12a	G	A	7: 104,306,994	A113V	probably benign	Het
Vil1	T	C	1: 74,427,613	V654A	probably benign	Het
Vmn1r202	T	C	13: 22,501,900	T116A	possibly damaging	Het
Zfp607a	G	A	7: 27,879,401	R632H	probably benign	Het

Other mutations in Clptm1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01672:Clptm1l	APN	13	73607873	splice site	probably null
IGL01963:Clptm1l	APN	13	73617569	splice site	probably benign
IGL02169:Clptm1l	APN	13	73611663	missense	probably damaging	0.96
IGL02554:Clptm1l	APN	13	73607760	missense	probably benign	0.07
IGL02596:Clptm1l	APN	13	73613666	missense	probably benign	0.02
IGL02720:Clptm1l	APN	13	73614602	splice site	probably benign
IGL03100:Clptm1l	APN	13	73612390	splice site	probably benign
P0023:Clptm1l	UTSW	13	73604952	missense	possibly damaging	0.67
R0308:Clptm1l	UTSW	13	73611667	missense	possibly damaging	0.67
R0725:Clptm1l	UTSW	13	73606343	missense	probably benign
R1572:Clptm1l	UTSW	13	73607747	missense	probably benign
R1589:Clptm1l	UTSW	13	73614673	critical splice donor site	probably null
R2062:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2064:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2065:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2067:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2068:Clptm1l	UTSW	13	73607723	nonsense	probably null
R3003:Clptm1l	UTSW	13	73617756	missense	possibly damaging	0.51
R3712:Clptm1l	UTSW	13	73616038	missense	probably benign	0.21
R3966:Clptm1l	UTSW	13	73615972	missense	probably damaging	1.00
R4615:Clptm1l	UTSW	13	73607738	nonsense	probably null
R4801:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4802:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4957:Clptm1l	UTSW	13	73611196	missense	possibly damaging	0.52
R4957:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00
R5864:Clptm1l	UTSW	13	73606284	missense	probably damaging	0.99
R6502:Clptm1l	UTSW	13	73617765	critical splice donor site	probably null
R6701:Clptm1l	UTSW	13	73608906	missense	probably benign	0.00
R6720:Clptm1l	UTSW	13	73618516	missense	probably damaging	1.00
R7782:Clptm1l	UTSW	13	73604320	missense	probably damaging	1.00
R8292:Clptm1l	UTSW	13	73617735	missense	probably damaging	0.96
R8329:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTTTGAGACGTGAAGTGG -3'
(R):5'- GATGCTCACTGACTGCTGAG -3'

Sequencing Primer
(F):5'- GTTCCGTAGACAGTGAACATGTC -3'
(R):5'- TGACTGCTGAGCCTGCTGAG -3'

Posted On

2015-04-02