Incidental Mutation 'R3808:Med15'
ID275065
Institutional Source Beutler Lab
Gene Symbol Med15
Ensembl Gene ENSMUSG00000012114
Gene Namemediator complex subunit 15
SynonymsPcqap, A230074L19Rik
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17651208-17732891 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 17655734 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000012259] [ENSMUST00000056962] [ENSMUST00000080936] [ENSMUST00000182117] [ENSMUST00000231674] [ENSMUST00000232236] [ENSMUST00000232645]
Predicted Effect unknown
Transcript: ENSMUST00000012259
AA Change: M452I
SMART Domains Protein: ENSMUSP00000012259
Gene: ENSMUSG00000012114
AA Change: M452I

DomainStartEndE-ValueType
Pfam:Med15 17 789 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056962
SMART Domains Protein: ENSMUSP00000049541
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 50 105 4.1e-24 PFAM
low complexity region 154 164 N/A INTRINSIC
Pfam:CCDC74_C 209 326 1.4e-49 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000080936
AA Change: M412I
SMART Domains Protein: ENSMUSP00000079737
Gene: ENSMUSG00000012114
AA Change: M412I

DomainStartEndE-ValueType
Pfam:Med15 17 749 1.2e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182117
SMART Domains Protein: ENSMUSP00000138657
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 1 21 N/A INTRINSIC
Pfam:CCDC92 36 97 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182671
Predicted Effect probably benign
Transcript: ENSMUST00000183279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231480
Predicted Effect unknown
Transcript: ENSMUST00000231674
AA Change: C47Y
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232012
Predicted Effect unknown
Transcript: ENSMUST00000232236
AA Change: M452I
Predicted Effect unknown
Transcript: ENSMUST00000232645
AA Change: M302I
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Med15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Med15 APN 16 17680726 missense probably damaging 0.96
IGL00780:Med15 APN 16 17653487 missense probably damaging 1.00
IGL02365:Med15 APN 16 17671606 intron probably benign
R0324:Med15 UTSW 16 17697612 missense probably damaging 0.98
R1225:Med15 UTSW 16 17722788 missense probably damaging 1.00
R1695:Med15 UTSW 16 17722780 missense probably damaging 0.96
R1745:Med15 UTSW 16 17655706 unclassified probably benign
R1801:Med15 UTSW 16 17680735 missense possibly damaging 0.66
R1838:Med15 UTSW 16 17653562 missense probably benign 0.11
R1901:Med15 UTSW 16 17673154 unclassified probably benign
R2153:Med15 UTSW 16 17685451 critical splice donor site probably null
R2974:Med15 UTSW 16 17652711 missense probably damaging 1.00
R3809:Med15 UTSW 16 17655734 unclassified probably benign
R4240:Med15 UTSW 16 17655494 missense probably damaging 1.00
R4483:Med15 UTSW 16 17671564 intron probably benign
R4484:Med15 UTSW 16 17671564 intron probably benign
R4577:Med15 UTSW 16 17674515 nonsense probably null
R5652:Med15 UTSW 16 17655191 missense probably damaging 1.00
R6244:Med15 UTSW 16 17652745 nonsense probably null
R6701:Med15 UTSW 16 17671583 intron probably benign
R6793:Med15 UTSW 16 17652703 unclassified probably benign
R7036:Med15 UTSW 16 17698155 start codon destroyed probably null
R7038:Med15 UTSW 16 17652727 missense possibly damaging 0.90
R7211:Med15 UTSW 16 17698113 missense unknown
R7317:Med15 UTSW 16 17671643 missense unknown
R7390:Med15 UTSW 16 17722762 missense unknown
R7471:Med15 UTSW 16 17722865 missense probably benign 0.03
R7726:Med15 UTSW 16 17655174 missense possibly damaging 0.87
Z1177:Med15 UTSW 16 17653232 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGTCACTGGGCTCTGAGAAG -3'
(R):5'- TATGTGTGCCCAGAGGTAAGG -3'

Sequencing Primer
(F):5'- CTCTGAGAAGGCTGTGGTGAAG -3'
(R):5'- CCAGAGGTAAGGCTTGTGC -3'
Posted On2015-04-02