Incidental Mutation 'R3808:Olfr127'
ID275067
Institutional Source Beutler Lab
Gene Symbol Olfr127
Ensembl Gene ENSMUSG00000058114
Gene Nameolfactory receptor 127
SynonymsMOR218-7, GA_x6K02T2PSCP-2354126-2355093
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37900437-37906795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37903573 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000149133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076331] [ENSMUST00000217223]
Predicted Effect probably benign
Transcript: ENSMUST00000076331
AA Change: V9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075669
Gene: ENSMUSG00000058114
AA Change: V9A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.7e-46 PFAM
Pfam:7tm_1 41 290 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217223
AA Change: V9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Olfr127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr127 APN 17 37904257 missense probably damaging 0.98
IGL00981:Olfr127 APN 17 37904181 missense probably benign 0.03
IGL02271:Olfr127 APN 17 37904243 missense probably benign 0.22
IGL02409:Olfr127 APN 17 37903788 missense probably damaging 0.99
R1649:Olfr127 UTSW 17 37904169 missense probably benign 0.09
R1808:Olfr127 UTSW 17 37903770 missense probably damaging 1.00
R2360:Olfr127 UTSW 17 37904454 missense possibly damaging 0.94
R3809:Olfr127 UTSW 17 37903573 missense probably benign 0.00
R3953:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R3955:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R3957:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R4683:Olfr127 UTSW 17 37904148 missense probably benign
R5430:Olfr127 UTSW 17 37904413 missense probably damaging 1.00
R5716:Olfr127 UTSW 17 37903828 missense probably benign 0.00
R5866:Olfr127 UTSW 17 37903809 nonsense probably null
R7074:Olfr127 UTSW 17 37903827 missense possibly damaging 0.80
R7238:Olfr127 UTSW 17 37904437 missense probably benign 0.37
R8098:Olfr127 UTSW 17 37904359 missense probably damaging 1.00
R8212:Olfr127 UTSW 17 37904257 missense probably benign 0.00
X0021:Olfr127 UTSW 17 37903756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGCTTGATAAACTGCAATTCC -3'
(R):5'- CATACTGGGGAACTGTGACAG -3'

Sequencing Primer
(F):5'- GCTTGATAAACTGCAATTCCTTAAAC -3'
(R):5'- TCCATAATGGAAAGGTGCTTCAG -3'
Posted On2015-04-02