Incidental Mutation 'R3808:Klhdc3'
ID275068
Institutional Source Beutler Lab
Gene Symbol Klhdc3
Ensembl Gene ENSMUSG00000063576
Gene Namekelch domain containing 3
Synonyms1300011D16Rik, Peas
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46674550-46680930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46677932 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 111 (N111Y)
Ref Sequence ENSEMBL: ENSMUSP00000128271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002845] [ENSMUST00000024766] [ENSMUST00000071841] [ENSMUST00000165007]
Predicted Effect probably benign
Transcript: ENSMUST00000002845
SMART Domains Protein: ENSMUSP00000002845
Gene: ENSMUSG00000002768

DomainStartEndE-ValueType
Pfam:MEA1 1 174 1.6e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024766
SMART Domains Protein: ENSMUSP00000024766
Gene: ENSMUSG00000023971

DomainStartEndE-ValueType
Pfam:DUF947 55 219 7.6e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071841
AA Change: N111Y

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071743
Gene: ENSMUSG00000063576
AA Change: N111Y

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 1.6e-8 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_4 13 65 3.8e-8 PFAM
Pfam:Kelch_6 13 67 9.6e-11 PFAM
Pfam:Kelch_5 73 113 3.1e-8 PFAM
Pfam:Kelch_1 76 117 1.9e-7 PFAM
Pfam:Kelch_6 76 121 1.7e-9 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_4 77 125 4.6e-11 PFAM
Pfam:Kelch_3 86 136 1.3e-12 PFAM
Pfam:Kelch_1 127 172 1.5e-10 PFAM
Pfam:Kelch_6 127 173 2e-10 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.3e-10 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_1 180 233 5.8e-9 PFAM
Pfam:Kelch_3 189 247 7.3e-8 PFAM
Pfam:Kelch_5 235 276 1.2e-11 PFAM
Pfam:Kelch_1 238 284 2.7e-8 PFAM
Pfam:Kelch_6 238 293 2.4e-12 PFAM
Pfam:Kelch_3 248 299 4.2e-10 PFAM
low complexity region 322 333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165007
AA Change: N111Y

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128271
Gene: ENSMUSG00000063576
AA Change: N111Y

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 9.9e-10 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_6 13 66 7.5e-11 PFAM
Pfam:Kelch_4 13 71 1.4e-8 PFAM
Pfam:Kelch_5 73 113 3e-8 PFAM
Pfam:Kelch_1 76 118 2.6e-8 PFAM
Pfam:Kelch_6 76 121 1.1e-10 PFAM
Pfam:Kelch_4 76 126 2e-11 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_3 86 136 7.7e-12 PFAM
Pfam:Kelch_1 127 170 1.2e-8 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.7e-7 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_6 179 239 2.5e-9 PFAM
Pfam:Kelch_1 180 232 3.4e-8 PFAM
Pfam:Kelch_3 189 247 5.7e-8 PFAM
Pfam:Kelch_5 235 276 4.3e-10 PFAM
Pfam:Kelch_1 238 285 9.3e-10 PFAM
Pfam:Kelch_4 238 291 9.9e-8 PFAM
Pfam:Kelch_6 238 293 2.5e-12 PFAM
Pfam:Kelch_3 248 299 1.1e-9 PFAM
low complexity region 322 333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six repeated kelch motifs that are structurally similar to recombination activating gene 2, a protein involved in the activation of the V(D)J recombination. In mouse, this gene is found to be expressed specifically in testis. Its expression in pachytene spermatocytes is localized to cytoplasma and meiotic chromatin, suggesting that this gene may be involved in meiotic recombination. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Klhdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Klhdc3 APN 17 46677300 missense possibly damaging 0.82
pinto UTSW 17 46678046 missense probably benign 0.36
shetland UTSW 17 46678292 missense possibly damaging 0.63
R0667:Klhdc3 UTSW 17 46677225 missense probably benign 0.07
R0960:Klhdc3 UTSW 17 46676518 missense possibly damaging 0.89
R1254:Klhdc3 UTSW 17 46678067 missense probably benign
R1263:Klhdc3 UTSW 17 46676966 missense probably benign 0.00
R1954:Klhdc3 UTSW 17 46677975 missense probably damaging 1.00
R2093:Klhdc3 UTSW 17 46677953 missense probably benign 0.00
R3809:Klhdc3 UTSW 17 46677932 missense possibly damaging 0.89
R4409:Klhdc3 UTSW 17 46677018 missense probably damaging 1.00
R4799:Klhdc3 UTSW 17 46677300 missense possibly damaging 0.82
R5807:Klhdc3 UTSW 17 46677465 missense probably damaging 0.98
R5958:Klhdc3 UTSW 17 46675102 missense probably benign 0.12
R6152:Klhdc3 UTSW 17 46677707 missense probably damaging 1.00
R6295:Klhdc3 UTSW 17 46678046 missense probably benign 0.36
R6521:Klhdc3 UTSW 17 46677761 missense probably benign 0.20
R6851:Klhdc3 UTSW 17 46678292 missense possibly damaging 0.63
R7524:Klhdc3 UTSW 17 46678414 missense probably damaging 0.99
Z1177:Klhdc3 UTSW 17 46676751 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAATGTACATGATCTTGCCCAGG -3'
(R):5'- TTGCGTTGGACAAAGCTGC -3'

Sequencing Primer
(F):5'- GGACACAAGCTGAATGTCCGTC -3'
(R):5'- AAAGCTGCCCCCAGTGAG -3'
Posted On2015-04-02