Incidental Mutation 'R3808:Plin3'
ID275069
Institutional Source Beutler Lab
Gene Symbol Plin3
Ensembl Gene ENSMUSG00000024197
Gene Nameperilipin 3
SynonymsTip47, M6prbp1, 1300012C15Rik
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56278962-56290511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 56286275 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 96 (A96S)
Ref Sequence ENSEMBL: ENSMUSP00000019726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019726]
PDB Structure
Crystal Structure of the C-terminus of TIP47 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000019726
AA Change: A96S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019726
Gene: ENSMUSG00000024197
AA Change: A96S

DomainStartEndE-ValueType
Pfam:Perilipin 19 415 1.5e-166 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mannose 6-phophate receptors (MPRs) deliver lysosomal hydrolase from the Golgi to endosomes and then return to the Golgi complex. The protein encoded by this gene interacts with the cytoplasmic domains of both cation-independent and cation-dependent MPRs, and is required for endosome-to-Golgi transport. This protein also binds directly to the GTPase RAB9 (RAB9A), a member of the RAS oncogene family. The interaction with RAB9 has been shown to increase the affinity of this protein for its cargo. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a null mutation display enhanced cold tolerance and increased beige adipocyte formation and thermogenic activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Plin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Plin3 APN 17 56279814 missense probably damaging 1.00
IGL01522:Plin3 APN 17 56280799 nonsense probably null
IGL01793:Plin3 APN 17 56281540 missense probably benign
IGL02355:Plin3 APN 17 56286636 missense probably benign 0.24
IGL02362:Plin3 APN 17 56286636 missense probably benign 0.24
R0053:Plin3 UTSW 17 56279892 missense probably damaging 1.00
R0053:Plin3 UTSW 17 56279892 missense probably damaging 1.00
R1458:Plin3 UTSW 17 56284337 missense probably benign 0.05
R1900:Plin3 UTSW 17 56279824 missense possibly damaging 0.47
R2107:Plin3 UTSW 17 56284391 missense probably benign 0.01
R2173:Plin3 UTSW 17 56279891 missense possibly damaging 0.77
R3030:Plin3 UTSW 17 56284184 missense possibly damaging 0.64
R3872:Plin3 UTSW 17 56284181 missense probably damaging 1.00
R4426:Plin3 UTSW 17 56286555 missense probably damaging 1.00
R5991:Plin3 UTSW 17 56286576 missense probably damaging 0.99
R6261:Plin3 UTSW 17 56281488 nonsense probably null
R6516:Plin3 UTSW 17 56286223 missense probably damaging 0.99
R7225:Plin3 UTSW 17 56286541 missense possibly damaging 0.46
R7574:Plin3 UTSW 17 56284192 missense possibly damaging 0.95
R7786:Plin3 UTSW 17 56279757 missense probably benign 0.04
R8325:Plin3 UTSW 17 56286268 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GATCCAGAGGGCATTCTTGAC -3'
(R):5'- AGTGAGTTGAGGACCCCAAG -3'

Sequencing Primer
(F):5'- TTGACTGAATGTGGCCAACC -3'
(R):5'- GGTGTGGAGGGAGAATGCCTC -3'
Posted On2015-04-02