Mutagenetix > Incidental Mutations

Incidental Mutation 'R3808:Plin3'

275069

Institutional Source

Beutler Lab

Gene Symbol

Plin3

Ensembl Gene

ENSMUSG00000024197

Gene Name

perilipin 3

Synonyms

Tip47, M6prbp1, 1300012C15Rik

MMRRC Submission

040765-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R3808 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56278962-56290511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 56286275 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 96 (A96S)

Ref Sequence

ENSEMBL: ENSMUSP00000019726 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019726]

PDB Structure

Crystal Structure of the C-terminus of TIP47 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000019726
AA Change: A96S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000019726
Gene: ENSMUSG00000024197
AA Change: A96S

Domain	Start	End	E-Value	Type
Pfam:Perilipin	19	415	1.5e-166	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mannose 6-phophate receptors (MPRs) deliver lysosomal hydrolase from the Golgi to endosomes and then return to the Golgi complex. The protein encoded by this gene interacts with the cytoplasmic domains of both cation-independent and cation-dependent MPRs, and is required for endosome-to-Golgi transport. This protein also binds directly to the GTPase RAB9 (RAB9A), a member of the RAS oncogene family. The interaction with RAB9 has been shown to increase the affinity of this protein for its cargo. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a null mutation display enhanced cold tolerance and increased beige adipocyte formation and thermogenic activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Aldh3a2	G	T	11: 61,258,797	L248M	probably damaging	Het
Als2	A	G	1: 59,170,450	S1458P	probably benign	Het
Arhgap5	A	G	12: 52,567,187	E192G	possibly damaging	Het
Atg2a	A	G	19: 6,252,816	K1019R	possibly damaging	Het
Atp2b1	A	G	10: 99,003,148	K613E	possibly damaging	Het
Carm1	T	C	9: 21,586,962	C421R	probably damaging	Het
Cdh17	A	T	4: 11,795,671	Y417F	probably damaging	Het
Cers1	A	G	8: 70,330,010	D10G	possibly damaging	Het
Clptm1l	A	C	13: 73,612,454	M319L	probably benign	Het
Cntnap3	A	G	13: 64,781,804	V527A	probably damaging	Het
Creb3l2	A	G	6: 37,355,690	S290P	probably damaging	Het
D3Ertd254e	T	G	3: 36,165,643		probably null	Het
Dock4	T	G	12: 40,672,810	V305G	probably damaging	Het
Dtl	A	C	1: 191,548,354	L356R	probably damaging	Het
Eftud2	A	T	11: 102,841,463		probably null	Het
Eif2b4	A	G	5: 31,191,168	S88P	possibly damaging	Het
Fat4	T	G	3: 38,982,438	V3413G	possibly damaging	Het
Fgfr2	T	C	7: 130,199,848	M218V	probably benign	Het
Grin2b	A	G	6: 135,923,271	L204P	probably damaging	Het
Kcnj12	A	G	11: 61,070,277	N467S	probably benign	Het
Klhdc3	T	A	17: 46,677,932	N111Y	possibly damaging	Het
Lin9	A	G	1: 180,659,111	I81V	probably null	Het
Lrp2	T	C	2: 69,501,548	D1621G	probably damaging	Het
Lrp4	T	A	2: 91,476,702	D389E	probably damaging	Het
Med15	C	T	16: 17,655,734		probably benign	Het
Nbea	T	C	3: 55,717,848	N2274S	probably benign	Het
Nr3c2	G	A	8: 76,908,714	G148D	probably damaging	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Olfr127	T	C	17: 37,903,573	V9A	probably benign	Het
Olfr982	A	T	9: 40,074,309	M5L	probably benign	Het
Paxip1	A	G	5: 27,772,029		probably benign	Het
Pfas	T	C	11: 68,989,953		probably benign	Het
Pnck	T	A	X: 73,656,944	I288F	probably damaging	Het
Ppp4c	C	T	7: 126,787,327	G166D	probably damaging	Het
Prss43	A	T	9: 110,827,772	R115S	probably damaging	Het
Rassf2	T	C	2: 131,998,260		probably null	Het
Rdh16f1	T	A	10: 127,788,699	D135E	probably benign	Het
Rdh16f1	G	A	10: 127,788,700	V136M	probably damaging	Het
Rgs12	A	G	5: 35,032,354	E702G	probably damaging	Het
Rnf213	A	G	11: 119,479,558	K4728E	probably damaging	Het
Ros1	T	G	10: 52,120,848	T1243P	probably benign	Het
Sall1	G	A	8: 89,031,473	Q668*	probably null	Het
Sbf2	C	A	7: 110,489,280	*45L	probably null	Het
Serpina3j	A	T	12: 104,319,827	I414F	probably benign	Het
Sh2d3c	T	C	2: 32,746,096	Y159H	probably damaging	Het
Slamf1	A	G	1: 171,798,177	D307G	probably null	Het
Slc22a13	T	C	9: 119,196,077	T178A	probably benign	Het
Smchd1	A	T	17: 71,429,541	L588H	probably damaging	Het
Svs1	C	T	6: 48,987,994	P312L	possibly damaging	Het
Trim12a	G	A	7: 104,306,994	A113V	probably benign	Het
Vil1	T	C	1: 74,427,613	V654A	probably benign	Het
Vmn1r202	T	C	13: 22,501,900	T116A	possibly damaging	Het
Zfp607a	G	A	7: 27,879,401	R632H	probably benign	Het

Other mutations in Plin3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Plin3	APN	17	56279814	missense	probably damaging	1.00
IGL01522:Plin3	APN	17	56280799	nonsense	probably null
IGL01793:Plin3	APN	17	56281540	missense	probably benign
IGL02355:Plin3	APN	17	56286636	missense	probably benign	0.24
IGL02362:Plin3	APN	17	56286636	missense	probably benign	0.24
R0053:Plin3	UTSW	17	56279892	missense	probably damaging	1.00
R0053:Plin3	UTSW	17	56279892	missense	probably damaging	1.00
R1458:Plin3	UTSW	17	56284337	missense	probably benign	0.05
R1900:Plin3	UTSW	17	56279824	missense	possibly damaging	0.47
R2107:Plin3	UTSW	17	56284391	missense	probably benign	0.01
R2173:Plin3	UTSW	17	56279891	missense	possibly damaging	0.77
R3030:Plin3	UTSW	17	56284184	missense	possibly damaging	0.64
R3872:Plin3	UTSW	17	56284181	missense	probably damaging	1.00
R4426:Plin3	UTSW	17	56286555	missense	probably damaging	1.00
R5991:Plin3	UTSW	17	56286576	missense	probably damaging	0.99
R6261:Plin3	UTSW	17	56281488	nonsense	probably null
R6516:Plin3	UTSW	17	56286223	missense	probably damaging	0.99
R7225:Plin3	UTSW	17	56286541	missense	possibly damaging	0.46
R7574:Plin3	UTSW	17	56284192	missense	possibly damaging	0.95
R7786:Plin3	UTSW	17	56279757	missense	probably benign	0.04
R8325:Plin3	UTSW	17	56286268	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GATCCAGAGGGCATTCTTGAC -3'
(R):5'- AGTGAGTTGAGGACCCCAAG -3'

Sequencing Primer
(F):5'- TTGACTGAATGTGGCCAACC -3'
(R):5'- GGTGTGGAGGGAGAATGCCTC -3'

Posted On

2015-04-02