Incidental Mutation 'R3808:Smchd1'
ID275070
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene NameSMC hinge domain containing 1
Synonyms4931400A14Rik, MommeD1
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71344489-71475343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71429541 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 588 (L588H)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
Predicted Effect probably damaging
Transcript: ENSMUST00000127430
AA Change: L588H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: L588H

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71465673 splice site probably benign
IGL00529:Smchd1 APN 17 71394799 missense probably benign 0.30
IGL00642:Smchd1 APN 17 71390432 missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71398623 missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71436788 missense probably benign
IGL01432:Smchd1 APN 17 71431290 missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71389750 missense probably benign 0.00
IGL01705:Smchd1 APN 17 71381398 missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71391418 missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71378187 missense probably benign 0.01
IGL01976:Smchd1 APN 17 71394725 nonsense probably null
IGL01995:Smchd1 APN 17 71444020 missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71431253 missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71358133 splice site probably benign
IGL02309:Smchd1 APN 17 71443903 missense probably benign 0.32
IGL02391:Smchd1 APN 17 71431259 missense probably null 1.00
IGL02515:Smchd1 APN 17 71440957 missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71360021 splice site probably benign
IGL03081:Smchd1 APN 17 71360191 missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71443891 missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71391430 missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71349700 missense probably benign 0.01
R0049:Smchd1 UTSW 17 71431236 missense probably benign 0.01
R0254:Smchd1 UTSW 17 71411891 missense probably benign 0.00
R0391:Smchd1 UTSW 17 71403154 missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71394902 missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71387088 missense probably benign
R0520:Smchd1 UTSW 17 71429543 missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71379574 missense probably benign 0.39
R1120:Smchd1 UTSW 17 71358146 nonsense probably null
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71361837 splice site probably benign
R1484:Smchd1 UTSW 17 71378257 missense probably benign 0.31
R1501:Smchd1 UTSW 17 71365094 missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71448833 missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71400201 splice site probably benign
R1766:Smchd1 UTSW 17 71391379 missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71387006 missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71370337 missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71389771 missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71463791 missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71370928 missense probably benign 0.15
R2147:Smchd1 UTSW 17 71398588 missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71463799 missense probably benign 0.23
R2398:Smchd1 UTSW 17 71360141 missense probably damaging 1.00
R2398:Smchd1 UTSW 17 71426436 splice site probably benign
R2935:Smchd1 UTSW 17 71411905 missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71363038 missense probably benign 0.00
R3021:Smchd1 UTSW 17 71387098 missense possibly damaging 0.75
R4323:Smchd1 UTSW 17 71428275 missense probably benign 0.00
R4486:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4487:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4488:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4489:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4723:Smchd1 UTSW 17 71436747 nonsense probably null
R4751:Smchd1 UTSW 17 71391468 missense probably benign 0.01
R4798:Smchd1 UTSW 17 71360053 nonsense probably null
R4814:Smchd1 UTSW 17 71411768 critical splice donor site probably null
R4882:Smchd1 UTSW 17 71358239 intron probably benign
R5088:Smchd1 UTSW 17 71431348 missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71440961 missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71455727 missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71394862 missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71365409 missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71440956 missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71377057 nonsense probably null
R6082:Smchd1 UTSW 17 71349719 missense probably benign 0.09
R6126:Smchd1 UTSW 17 71370285 missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71370927 missense probably benign 0.13
R6788:Smchd1 UTSW 17 71475101 missense probably benign 0.02
R6853:Smchd1 UTSW 17 71436743 missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71353506 missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71349667 missense probably benign
R7045:Smchd1 UTSW 17 71415044 missense probably benign 0.22
R7068:Smchd1 UTSW 17 71387092 missense probably benign 0.00
R7085:Smchd1 UTSW 17 71365219 splice site probably null
R7089:Smchd1 UTSW 17 71361960 missense probably benign 0.00
R7145:Smchd1 UTSW 17 71378207 missense probably benign
R7158:Smchd1 UTSW 17 71400150 missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71394823 missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71353516 missense probably benign 0.00
R7214:Smchd1 UTSW 17 71345364 missense probably benign 0.15
R7414:Smchd1 UTSW 17 71475079 missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71381369 missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71398689 missense probably benign 0.10
R7641:Smchd1 UTSW 17 71390479 missense probably benign 0.00
R7709:Smchd1 UTSW 17 71358198 missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71411911 missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71361841 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCCACTGAAACTTACATAAGC -3'
(R):5'- CAGAAACTTTTACTCTGTGCTACTC -3'

Sequencing Primer
(F):5'- TACCAGTTGGCCTGCTTT -3'
(R):5'- GATAAACCTGTACAACTCTATGTGTC -3'
Posted On2015-04-02