Mutagenetix > Incidental Mutations

Incidental Mutation 'R3808:Atg2a'

275071

Institutional Source

Beutler Lab

Gene Symbol

Atg2a

Ensembl Gene

ENSMUSG00000024773

Gene Name

autophagy related 2A

Synonyms

MMRRC Submission

040765-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R3808 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6241668-6262335 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 6252816 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1019 (K1019R)

Ref Sequence

ENSEMBL: ENSMUSP00000046412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045351]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045351
AA Change: K1019R

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000046412
Gene: ENSMUSG00000024773
AA Change: K1019R

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	14	131	7.6e-20	PFAM
low complexity region	138	154	N/A	INTRINSIC
low complexity region	285	301	N/A	INTRINSIC
low complexity region	501	512	N/A	INTRINSIC
low complexity region	852	863	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC
low complexity region	1429	1446	N/A	INTRINSIC
low complexity region	1761	1773	N/A	INTRINSIC
Pfam:ATG_C	1814	1908	2.2e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135018

Predicted Effect

probably benign
Transcript: ENSMUST00000145600
AA Change: K820R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000114998
Gene: ENSMUSG00000024773
AA Change: K820R

Domain	Start	End	E-Value	Type
low complexity region	87	103	N/A	INTRINSIC
low complexity region	303	314	N/A	INTRINSIC
low complexity region	654	665	N/A	INTRINSIC
low complexity region	871	883	N/A	INTRINSIC
low complexity region	1233	1250	N/A	INTRINSIC
low complexity region	1565	1577	N/A	INTRINSIC
Pfam:ATG_C	1618	1712	3.6e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151079

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Aldh3a2	G	T	11: 61,258,797	L248M	probably damaging	Het
Als2	A	G	1: 59,170,450	S1458P	probably benign	Het
Arhgap5	A	G	12: 52,567,187	E192G	possibly damaging	Het
Atp2b1	A	G	10: 99,003,148	K613E	possibly damaging	Het
Carm1	T	C	9: 21,586,962	C421R	probably damaging	Het
Cdh17	A	T	4: 11,795,671	Y417F	probably damaging	Het
Cers1	A	G	8: 70,330,010	D10G	possibly damaging	Het
Clptm1l	A	C	13: 73,612,454	M319L	probably benign	Het
Cntnap3	A	G	13: 64,781,804	V527A	probably damaging	Het
Creb3l2	A	G	6: 37,355,690	S290P	probably damaging	Het
D3Ertd254e	T	G	3: 36,165,643		probably null	Het
Dock4	T	G	12: 40,672,810	V305G	probably damaging	Het
Dtl	A	C	1: 191,548,354	L356R	probably damaging	Het
Eftud2	A	T	11: 102,841,463		probably null	Het
Eif2b4	A	G	5: 31,191,168	S88P	possibly damaging	Het
Fat4	T	G	3: 38,982,438	V3413G	possibly damaging	Het
Fgfr2	T	C	7: 130,199,848	M218V	probably benign	Het
Grin2b	A	G	6: 135,923,271	L204P	probably damaging	Het
Kcnj12	A	G	11: 61,070,277	N467S	probably benign	Het
Klhdc3	T	A	17: 46,677,932	N111Y	possibly damaging	Het
Lin9	A	G	1: 180,659,111	I81V	probably null	Het
Lrp2	T	C	2: 69,501,548	D1621G	probably damaging	Het
Lrp4	T	A	2: 91,476,702	D389E	probably damaging	Het
Med15	C	T	16: 17,655,734		probably benign	Het
Nbea	T	C	3: 55,717,848	N2274S	probably benign	Het
Nr3c2	G	A	8: 76,908,714	G148D	probably damaging	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Olfr127	T	C	17: 37,903,573	V9A	probably benign	Het
Olfr982	A	T	9: 40,074,309	M5L	probably benign	Het
Paxip1	A	G	5: 27,772,029		probably benign	Het
Pfas	T	C	11: 68,989,953		probably benign	Het
Plin3	C	A	17: 56,286,275	A96S	probably damaging	Het
Pnck	T	A	X: 73,656,944	I288F	probably damaging	Het
Ppp4c	C	T	7: 126,787,327	G166D	probably damaging	Het
Prss43	A	T	9: 110,827,772	R115S	probably damaging	Het
Rassf2	T	C	2: 131,998,260		probably null	Het
Rdh16f1	T	A	10: 127,788,699	D135E	probably benign	Het
Rdh16f1	G	A	10: 127,788,700	V136M	probably damaging	Het
Rgs12	A	G	5: 35,032,354	E702G	probably damaging	Het
Rnf213	A	G	11: 119,479,558	K4728E	probably damaging	Het
Ros1	T	G	10: 52,120,848	T1243P	probably benign	Het
Sall1	G	A	8: 89,031,473	Q668*	probably null	Het
Sbf2	C	A	7: 110,489,280	*45L	probably null	Het
Serpina3j	A	T	12: 104,319,827	I414F	probably benign	Het
Sh2d3c	T	C	2: 32,746,096	Y159H	probably damaging	Het
Slamf1	A	G	1: 171,798,177	D307G	probably null	Het
Slc22a13	T	C	9: 119,196,077	T178A	probably benign	Het
Smchd1	A	T	17: 71,429,541	L588H	probably damaging	Het
Svs1	C	T	6: 48,987,994	P312L	possibly damaging	Het
Trim12a	G	A	7: 104,306,994	A113V	probably benign	Het
Vil1	T	C	1: 74,427,613	V654A	probably benign	Het
Vmn1r202	T	C	13: 22,501,900	T116A	possibly damaging	Het
Zfp607a	G	A	7: 27,879,401	R632H	probably benign	Het

Other mutations in Atg2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Atg2a	APN	19	6254599	missense	probably damaging	1.00
IGL01612:Atg2a	APN	19	6252484	missense	probably benign	0.03
IGL02105:Atg2a	APN	19	6250403	splice site	probably benign
IGL02151:Atg2a	APN	19	6255757	missense	possibly damaging	0.95
IGL02228:Atg2a	APN	19	6246800	missense	probably benign	0.29
IGL02329:Atg2a	APN	19	6249929	critical splice donor site	probably null
IGL02408:Atg2a	APN	19	6241828	nonsense	probably null
IGL02538:Atg2a	APN	19	6257628	missense	probably benign
IGL02830:Atg2a	APN	19	6247681	missense	probably benign	0.04
IGL03349:Atg2a	APN	19	6258024	missense	possibly damaging	0.77
PIT4515001:Atg2a	UTSW	19	6253585	missense	probably damaging	1.00
R0099:Atg2a	UTSW	19	6252789	missense	probably damaging	0.97
R0212:Atg2a	UTSW	19	6246554	missense	probably damaging	1.00
R0365:Atg2a	UTSW	19	6247683	missense	possibly damaging	0.51
R0398:Atg2a	UTSW	19	6246578	missense	probably damaging	1.00
R0483:Atg2a	UTSW	19	6256601	missense	probably damaging	0.98
R0483:Atg2a	UTSW	19	6256602	missense	probably benign	0.01
R0494:Atg2a	UTSW	19	6253377	missense	probably damaging	1.00
R0511:Atg2a	UTSW	19	6252539	missense	possibly damaging	0.89
R0590:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0592:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0593:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0630:Atg2a	UTSW	19	6244517	missense	probably damaging	0.99
R1306:Atg2a	UTSW	19	6253021	missense	probably benign	0.31
R1437:Atg2a	UTSW	19	6250616	missense	probably damaging	1.00
R1539:Atg2a	UTSW	19	6246771	splice site	probably null
R1774:Atg2a	UTSW	19	6250598	missense	probably benign	0.01
R1781:Atg2a	UTSW	19	6256213	missense	probably damaging	0.96
R1854:Atg2a	UTSW	19	6252431	missense	probably benign	0.11
R1884:Atg2a	UTSW	19	6254384	missense	probably damaging	1.00
R1899:Atg2a	UTSW	19	6245067	missense	probably damaging	1.00
R1935:Atg2a	UTSW	19	6252536	missense	probably damaging	1.00
R2020:Atg2a	UTSW	19	6250269	critical splice donor site	probably null
R2071:Atg2a	UTSW	19	6257458	missense	probably benign	0.00
R2513:Atg2a	UTSW	19	6258046	critical splice donor site	probably null
R4065:Atg2a	UTSW	19	6258366	missense	probably damaging	1.00
R4109:Atg2a	UTSW	19	6258374	missense	possibly damaging	0.95
R4352:Atg2a	UTSW	19	6257457	missense	probably benign	0.04
R4440:Atg2a	UTSW	19	6255829	critical splice donor site	probably null
R4472:Atg2a	UTSW	19	6258955	missense	probably damaging	0.98
R4669:Atg2a	UTSW	19	6258987	critical splice donor site	probably null
R4878:Atg2a	UTSW	19	6250244	missense	probably damaging	1.00
R4926:Atg2a	UTSW	19	6257533	missense	probably damaging	0.96
R5237:Atg2a	UTSW	19	6246814	missense	probably benign
R5350:Atg2a	UTSW	19	6251338	missense	probably damaging	0.99
R5507:Atg2a	UTSW	19	6245070	missense	possibly damaging	0.94
R5732:Atg2a	UTSW	19	6257460	missense	probably damaging	1.00
R5784:Atg2a	UTSW	19	6261505	missense	probably damaging	1.00
R5960:Atg2a	UTSW	19	6254360	missense	probably damaging	1.00
R5985:Atg2a	UTSW	19	6254637	missense	probably damaging	1.00
R6175:Atg2a	UTSW	19	6241729	unclassified	probably benign
R6572:Atg2a	UTSW	19	6254665	missense	probably damaging	0.98
R6878:Atg2a	UTSW	19	6250178	missense	probably damaging	0.99
R6879:Atg2a	UTSW	19	6251852	missense	possibly damaging	0.70
R6983:Atg2a	UTSW	19	6260040	missense	probably damaging	0.99
R7024:Atg2a	UTSW	19	6250219	missense	possibly damaging	0.88
R7217:Atg2a	UTSW	19	6253441	critical splice donor site	probably null
R7384:Atg2a	UTSW	19	6261677	missense	probably damaging	1.00
R7387:Atg2a	UTSW	19	6255168	missense	possibly damaging	0.79
R7425:Atg2a	UTSW	19	6255652	missense	probably benign	0.02
R7512:Atg2a	UTSW	19	6260076	missense	probably damaging	1.00
R7658:Atg2a	UTSW	19	6251263	missense	probably damaging	1.00
R7893:Atg2a	UTSW	19	6251296	missense	probably damaging	1.00
R8062:Atg2a	UTSW	19	6252579	critical splice donor site	probably null
R8258:Atg2a	UTSW	19	6249829	missense	probably damaging	0.98
R8259:Atg2a	UTSW	19	6249829	missense	probably damaging	0.98
R8350:Atg2a	UTSW	19	6246811	missense	probably benign	0.03
R8412:Atg2a	UTSW	19	6244524	missense	probably damaging	1.00
R8450:Atg2a	UTSW	19	6246811	missense	probably benign	0.03
R8474:Atg2a	UTSW	19	6251403	critical splice donor site	probably null
R8501:Atg2a	UTSW	19	6254390	missense	probably damaging	1.00
X0065:Atg2a	UTSW	19	6258196	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TCGAGGTATGGGAGTCACTG -3'
(R):5'- ATTCCTGGAGAGGGAAGTGC -3'

Sequencing Primer
(F):5'- TGGGAGTCACTGAAACATACATC -3'
(R):5'- CCTGGAGAGGGAAGTGCAGTTAG -3'

Posted On

2015-04-02