Incidental Mutation 'R3809:Armc3'
ID275078
Institutional Source Beutler Lab
Gene Symbol Armc3
Ensembl Gene ENSMUSG00000037683
Gene Namearmadillo repeat containing 3
Synonyms4921513G22Rik
MMRRC Submission 040766-MU
Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3809 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location19199302-19310241 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19300665 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 757 (A757S)
Ref Sequence ENSEMBL: ENSMUSP00000110287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]
Predicted Effect probably damaging
Transcript: ENSMUST00000049255
AA Change: A745S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: A745S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
low complexity region 544 557 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 675 696 N/A INTRINSIC
Pfam:EDR1 723 857 3.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114640
AA Change: A757S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: A757S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
Pfam:EDR1 549 868 1.4e-41 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
3425401B19Rik T C 14: 32,663,693 Y105C possibly damaging Het
Apol7e A T 15: 77,718,062 T287S probably benign Het
Arhgap12 A T 18: 6,037,057 N561K probably benign Het
Baz2b A T 2: 59,968,896 S295T probably benign Het
Brd4 T A 17: 32,211,270 K686N possibly damaging Het
Btnl6 T C 17: 34,508,228 T443A probably benign Het
Cacna1g T C 11: 94,416,096 T1801A probably damaging Het
Celsr2 G A 3: 108,403,239 T1509I possibly damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Cog1 G T 11: 113,655,010 M370I probably benign Het
Col6a6 C G 9: 105,780,692 V774L probably damaging Het
Csf1r T A 18: 61,112,764 S264R probably benign Het
Ctnna2 A T 6: 76,954,757 V620D probably damaging Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Frmd4b G A 6: 97,323,729 L214F possibly damaging Het
Fstl1 T A 16: 37,826,751 L161Q probably damaging Het
Hdac1 A G 4: 129,524,320 F94S probably damaging Het
Hlf T C 11: 90,388,103 D45G probably benign Het
Hps3 A T 3: 20,018,812 M501K probably damaging Het
Ighv14-4 A G 12: 114,176,554 Y79H probably damaging Het
Ip6k1 T A 9: 108,045,887 V406D probably damaging Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Itga11 A G 9: 62,771,382 T944A probably benign Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Kmt2c T C 5: 25,409,138 R195G possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Neb A G 2: 52,256,789 I2821T possibly damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr447 A T 6: 42,912,337 K271N probably damaging Het
Olfr657 A T 7: 104,636,333 I220L possibly damaging Het
Olfr918 C T 9: 38,672,863 V207I probably benign Het
Papd7 A G 13: 69,512,996 V51A probably damaging Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Pfdn1 C T 18: 36,451,092 G63D probably damaging Het
Pgghg T C 7: 140,945,295 F405L probably damaging Het
Plcd3 T C 11: 103,101,383 M50V probably null Het
Plekha8 C A 6: 54,619,349 S198R probably benign Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rnf217 T A 10: 31,503,808 I473F possibly damaging Het
Sec16a G C 2: 26,441,813 N63K possibly damaging Het
Sik3 A G 9: 46,219,486 D1240G probably benign Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc2a3 A G 6: 122,732,429 I337T probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tinag C T 9: 76,951,905 D474N probably benign Het
Ublcp1 A G 11: 44,458,282 F242L probably benign Het
Ucp1 C A 8: 83,290,641 A20D probably damaging Het
Ugt1a7c C T 1: 88,095,382 R88W possibly damaging Het
Wipf3 A G 6: 54,481,795 D45G probably damaging Het
Zfp592 G A 7: 81,024,532 A415T probably benign Het
Other mutations in Armc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Armc3 APN 2 19303858 missense possibly damaging 0.48
IGL01123:Armc3 APN 2 19201805 missense possibly damaging 0.87
IGL01142:Armc3 APN 2 19297898 splice site probably benign
IGL01556:Armc3 APN 2 19269146 missense probably damaging 1.00
IGL02145:Armc3 APN 2 19296860 missense possibly damaging 0.81
IGL02145:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02152:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02154:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02243:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02244:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02516:Armc3 APN 2 19300506 missense possibly damaging 0.94
IGL02691:Armc3 APN 2 19235484 missense probably damaging 1.00
IGL03151:Armc3 APN 2 19238698 missense probably damaging 1.00
IGL03190:Armc3 APN 2 19288950 missense probably damaging 0.99
IGL03288:Armc3 APN 2 19235482 missense probably damaging 1.00
IGL03338:Armc3 APN 2 19248701 missense possibly damaging 0.88
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0256:Armc3 UTSW 2 19269216 missense probably damaging 1.00
R0621:Armc3 UTSW 2 19295393 missense probably damaging 0.96
R1326:Armc3 UTSW 2 19310124 makesense probably null
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1489:Armc3 UTSW 2 19310047 missense probably benign 0.01
R1990:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1991:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1992:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R2002:Armc3 UTSW 2 19288936 missense probably benign 0.01
R2095:Armc3 UTSW 2 19288929 missense possibly damaging 0.65
R2127:Armc3 UTSW 2 19201811 missense probably damaging 1.00
R2158:Armc3 UTSW 2 19248633 missense probably damaging 0.99
R2697:Armc3 UTSW 2 19303935 missense probably damaging 1.00
R3897:Armc3 UTSW 2 19269177 missense probably damaging 1.00
R4107:Armc3 UTSW 2 19288909 missense probably benign 0.13
R4326:Armc3 UTSW 2 19300473 missense probably damaging 0.97
R4464:Armc3 UTSW 2 19248659 missense probably damaging 0.99
R4702:Armc3 UTSW 2 19309981 missense probably damaging 1.00
R4923:Armc3 UTSW 2 19292980 critical splice acceptor site probably null
R5370:Armc3 UTSW 2 19286062 missense probably benign 0.00
R5518:Armc3 UTSW 2 19297928 missense probably benign 0.28
R5718:Armc3 UTSW 2 19303799 nonsense probably null
R5739:Armc3 UTSW 2 19253917 missense possibly damaging 0.67
R5913:Armc3 UTSW 2 19310047 missense possibly damaging 0.65
R6211:Armc3 UTSW 2 19296803 critical splice acceptor site probably null
R6245:Armc3 UTSW 2 19248705 missense probably damaging 1.00
R6841:Armc3 UTSW 2 19201819 splice site probably null
R7003:Armc3 UTSW 2 19270028 missense probably damaging 1.00
R7190:Armc3 UTSW 2 19293136 missense probably damaging 1.00
R7499:Armc3 UTSW 2 19285979 missense probably benign 0.03
R7738:Armc3 UTSW 2 19288950 missense probably damaging 0.99
R7844:Armc3 UTSW 2 19254018 missense possibly damaging 0.90
R7919:Armc3 UTSW 2 19286095 missense probably benign 0.00
R8060:Armc3 UTSW 2 19288909 missense probably benign 0.08
R8111:Armc3 UTSW 2 19296863 missense probably benign
R8406:Armc3 UTSW 2 19235554 missense probably damaging 0.98
R8485:Armc3 UTSW 2 19293134 missense probably damaging 1.00
Z1177:Armc3 UTSW 2 19285991 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATTTCGACAGGATATGGGG -3'
(R):5'- CACCCGTGTGTGAGTCATTGTG -3'

Sequencing Primer
(F):5'- ACAGGATATGGGGTTTTATTATTGC -3'
(R):5'- GAAAAGCAAACCACTGTAAGT -3'
Posted On2015-04-02