Incidental Mutation 'R3809:Olfr447'
ID275093
Institutional Source Beutler Lab
Gene Symbol Olfr447
Ensembl Gene ENSMUSG00000045708
Gene Nameolfactory receptor 447
SynonymsMOR261-1, GA_x6K02T2P3E9-4647978-4647046
MMRRC Submission 040766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R3809 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42908878-42914273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42912337 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 271 (K271N)
Ref Sequence ENSEMBL: ENSMUSP00000149325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055763] [ENSMUST00000216408]
Predicted Effect probably damaging
Transcript: ENSMUST00000055763
AA Change: K271N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052312
Gene: ENSMUSG00000045708
AA Change: K271N

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.8e-60 PFAM
Pfam:7tm_1 40 289 6.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216408
AA Change: K271N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
3425401B19Rik T C 14: 32,663,693 Y105C possibly damaging Het
Apol7e A T 15: 77,718,062 T287S probably benign Het
Arhgap12 A T 18: 6,037,057 N561K probably benign Het
Armc3 G T 2: 19,300,665 A757S probably damaging Het
Baz2b A T 2: 59,968,896 S295T probably benign Het
Brd4 T A 17: 32,211,270 K686N possibly damaging Het
Btnl6 T C 17: 34,508,228 T443A probably benign Het
Cacna1g T C 11: 94,416,096 T1801A probably damaging Het
Celsr2 G A 3: 108,403,239 T1509I possibly damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Cog1 G T 11: 113,655,010 M370I probably benign Het
Col6a6 C G 9: 105,780,692 V774L probably damaging Het
Csf1r T A 18: 61,112,764 S264R probably benign Het
Ctnna2 A T 6: 76,954,757 V620D probably damaging Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Frmd4b G A 6: 97,323,729 L214F possibly damaging Het
Fstl1 T A 16: 37,826,751 L161Q probably damaging Het
Hdac1 A G 4: 129,524,320 F94S probably damaging Het
Hlf T C 11: 90,388,103 D45G probably benign Het
Hps3 A T 3: 20,018,812 M501K probably damaging Het
Ighv14-4 A G 12: 114,176,554 Y79H probably damaging Het
Ip6k1 T A 9: 108,045,887 V406D probably damaging Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Itga11 A G 9: 62,771,382 T944A probably benign Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Kmt2c T C 5: 25,409,138 R195G possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Neb A G 2: 52,256,789 I2821T possibly damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr657 A T 7: 104,636,333 I220L possibly damaging Het
Olfr918 C T 9: 38,672,863 V207I probably benign Het
Papd7 A G 13: 69,512,996 V51A probably damaging Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Pfdn1 C T 18: 36,451,092 G63D probably damaging Het
Pgghg T C 7: 140,945,295 F405L probably damaging Het
Plcd3 T C 11: 103,101,383 M50V probably null Het
Plekha8 C A 6: 54,619,349 S198R probably benign Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rnf217 T A 10: 31,503,808 I473F possibly damaging Het
Sec16a G C 2: 26,441,813 N63K possibly damaging Het
Sik3 A G 9: 46,219,486 D1240G probably benign Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc2a3 A G 6: 122,732,429 I337T probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tinag C T 9: 76,951,905 D474N probably benign Het
Ublcp1 A G 11: 44,458,282 F242L probably benign Het
Ucp1 C A 8: 83,290,641 A20D probably damaging Het
Ugt1a7c C T 1: 88,095,382 R88W possibly damaging Het
Wipf3 A G 6: 54,481,795 D45G probably damaging Het
Zfp592 G A 7: 81,024,532 A415T probably benign Het
Other mutations in Olfr447
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Olfr447 APN 6 42912338 missense probably damaging 1.00
IGL02604:Olfr447 APN 6 42912058 nonsense probably null
IGL02894:Olfr447 APN 6 42911517 splice site probably benign
R0122:Olfr447 UTSW 6 42911955 missense probably benign 0.00
R0172:Olfr447 UTSW 6 42911979 missense probably benign 0.00
R0371:Olfr447 UTSW 6 42911938 missense probably benign 0.14
R1709:Olfr447 UTSW 6 42912144 missense possibly damaging 0.94
R2431:Olfr447 UTSW 6 42912012 missense probably damaging 0.99
R4032:Olfr447 UTSW 6 42911625 missense probably benign 0.08
R4242:Olfr447 UTSW 6 42911546 missense possibly damaging 0.77
R4369:Olfr447 UTSW 6 42912277 nonsense probably null
R4401:Olfr447 UTSW 6 42912326 nonsense probably null
R4565:Olfr447 UTSW 6 42911538 missense probably benign
R5646:Olfr447 UTSW 6 42911523 splice site probably null
R5968:Olfr447 UTSW 6 42911546 missense probably benign
R6804:Olfr447 UTSW 6 42911918 missense probably benign
R6925:Olfr447 UTSW 6 42911857 nonsense probably null
R8170:Olfr447 UTSW 6 42912191 missense possibly damaging 0.73
R8358:Olfr447 UTSW 6 42912042 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GTGCTTGTCGGACCATTTTC -3'
(R):5'- TGAACAAGTTACATGTCCTGGTC -3'

Sequencing Primer
(F):5'- GTCGGACCATTTTCTTCAATTGTAG -3'
(R):5'- GTCCTCTTCAGAGCACTT -3'
Posted On2015-04-02