Incidental Mutation 'R3809:Ctnna2'
ID275097
Institutional Source Beutler Lab
Gene Symbol Ctnna2
Ensembl Gene ENSMUSG00000063063
Gene Namecatenin (cadherin associated protein), alpha 2
Synonymschp, Catna, alpha N-catenin, alpha(N)-catenin, Catna2
MMRRC Submission 040766-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R3809 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location76881637-77979699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76954757 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 620 (V620D)
Ref Sequence ENSEMBL: ENSMUSP00000124376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075340] [ENSMUST00000159626] [ENSMUST00000160894] [ENSMUST00000161846] [ENSMUST00000204527]
Predicted Effect probably damaging
Transcript: ENSMUST00000075340
AA Change: V620D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074809
Gene: ENSMUSG00000063063
AA Change: V620D

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 2e-104 PFAM
Pfam:Vinculin 331 866 7.7e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159626
AA Change: V620D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124376
Gene: ENSMUSG00000063063
AA Change: V620D

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 3.4e-105 PFAM
Pfam:Vinculin 330 914 6.6e-214 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160894
AA Change: V633D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124764
Gene: ENSMUSG00000063063
AA Change: V633D

DomainStartEndE-ValueType
Pfam:Vinculin 31 352 2.1e-104 PFAM
Pfam:Vinculin 343 927 4.6e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161846
AA Change: V633D

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123714
Gene: ENSMUSG00000063063
AA Change: V633D

DomainStartEndE-ValueType
Pfam:Vinculin 31 350 5.3e-105 PFAM
Pfam:Vinculin 344 879 2.1e-222 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204527
SMART Domains Protein: ENSMUSP00000144890
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 2 232 2.9e-94 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Animals homozygous for a mutation of this gene exhibit ataxia, reduced body weight, reduced male fertility, and abnormalities of the brain which include a hypoplastic cerebellum, abnormal foliation pattern, ectopic Purkinje cells, and abnormal pyramidal cells in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
3425401B19Rik T C 14: 32,663,693 Y105C possibly damaging Het
Apol7e A T 15: 77,718,062 T287S probably benign Het
Arhgap12 A T 18: 6,037,057 N561K probably benign Het
Armc3 G T 2: 19,300,665 A757S probably damaging Het
Baz2b A T 2: 59,968,896 S295T probably benign Het
Brd4 T A 17: 32,211,270 K686N possibly damaging Het
Btnl6 T C 17: 34,508,228 T443A probably benign Het
Cacna1g T C 11: 94,416,096 T1801A probably damaging Het
Celsr2 G A 3: 108,403,239 T1509I possibly damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Cog1 G T 11: 113,655,010 M370I probably benign Het
Col6a6 C G 9: 105,780,692 V774L probably damaging Het
Csf1r T A 18: 61,112,764 S264R probably benign Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Frmd4b G A 6: 97,323,729 L214F possibly damaging Het
Fstl1 T A 16: 37,826,751 L161Q probably damaging Het
Hdac1 A G 4: 129,524,320 F94S probably damaging Het
Hlf T C 11: 90,388,103 D45G probably benign Het
Hps3 A T 3: 20,018,812 M501K probably damaging Het
Ighv14-4 A G 12: 114,176,554 Y79H probably damaging Het
Ip6k1 T A 9: 108,045,887 V406D probably damaging Het
Iqcf1 T C 9: 106,501,878 S29P possibly damaging Het
Itga11 A G 9: 62,771,382 T944A probably benign Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Kmt2c T C 5: 25,409,138 R195G possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Neb A G 2: 52,256,789 I2821T possibly damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr447 A T 6: 42,912,337 K271N probably damaging Het
Olfr657 A T 7: 104,636,333 I220L possibly damaging Het
Olfr918 C T 9: 38,672,863 V207I probably benign Het
Papd7 A G 13: 69,512,996 V51A probably damaging Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Pfdn1 C T 18: 36,451,092 G63D probably damaging Het
Pgghg T C 7: 140,945,295 F405L probably damaging Het
Plcd3 T C 11: 103,101,383 M50V probably null Het
Plekha8 C A 6: 54,619,349 S198R probably benign Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rnf217 T A 10: 31,503,808 I473F possibly damaging Het
Sec16a G C 2: 26,441,813 N63K possibly damaging Het
Sik3 A G 9: 46,219,486 D1240G probably benign Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc2a3 A G 6: 122,732,429 I337T probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tinag C T 9: 76,951,905 D474N probably benign Het
Ublcp1 A G 11: 44,458,282 F242L probably benign Het
Ucp1 C A 8: 83,290,641 A20D probably damaging Het
Ugt1a7c C T 1: 88,095,382 R88W possibly damaging Het
Wipf3 A G 6: 54,481,795 D45G probably damaging Het
Zfp592 G A 7: 81,024,532 A415T probably benign Het
Other mutations in Ctnna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ctnna2 APN 6 76980761 missense probably damaging 1.00
IGL00573:Ctnna2 APN 6 76902281 intron probably benign
IGL01290:Ctnna2 APN 6 76882560 missense possibly damaging 0.89
IGL01719:Ctnna2 APN 6 77636975 nonsense probably null
IGL01725:Ctnna2 APN 6 77641365 missense possibly damaging 0.89
IGL02381:Ctnna2 APN 6 76954783 missense probably benign 0.27
IGL02561:Ctnna2 APN 6 77845580 missense probably benign 0.34
IGL02653:Ctnna2 APN 6 76980777 missense probably benign 0.00
IGL02658:Ctnna2 APN 6 76980824 missense probably benign 0.00
IGL02721:Ctnna2 APN 6 76981869 missense probably damaging 0.99
IGL03075:Ctnna2 APN 6 76954730 missense probably benign 0.14
IGL03291:Ctnna2 APN 6 76973712 missense probably damaging 1.00
R0379:Ctnna2 UTSW 6 77641440 missense probably benign 0.01
R0423:Ctnna2 UTSW 6 77653069 missense probably damaging 1.00
R0539:Ctnna2 UTSW 6 76973899 missense probably damaging 1.00
R0540:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R0545:Ctnna2 UTSW 6 77605182 missense probably damaging 1.00
R0559:Ctnna2 UTSW 6 76915850 missense probably damaging 1.00
R0582:Ctnna2 UTSW 6 77758417 missense probably benign 0.07
R0607:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R1318:Ctnna2 UTSW 6 76882790 missense probably damaging 1.00
R1754:Ctnna2 UTSW 6 77636749 missense possibly damaging 0.61
R1838:Ctnna2 UTSW 6 77845542 missense probably damaging 0.99
R1924:Ctnna2 UTSW 6 76954847 missense possibly damaging 0.75
R1969:Ctnna2 UTSW 6 77758500 missense probably damaging 0.99
R2011:Ctnna2 UTSW 6 76973791 missense possibly damaging 0.47
R2867:Ctnna2 UTSW 6 77114922 splice site probably benign
R3103:Ctnna2 UTSW 6 77653144 missense possibly damaging 0.66
R3772:Ctnna2 UTSW 6 76973769 missense probably damaging 0.99
R4023:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4024:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4025:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4026:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4288:Ctnna2 UTSW 6 77605221 missense probably damaging 0.96
R4291:Ctnna2 UTSW 6 76882745 missense probably damaging 1.00
R4493:Ctnna2 UTSW 6 76981848 missense probably damaging 0.99
R4561:Ctnna2 UTSW 6 77636713 critical splice donor site probably null
R4824:Ctnna2 UTSW 6 76980781 missense probably damaging 1.00
R4960:Ctnna2 UTSW 6 77653111 missense probably damaging 1.00
R4999:Ctnna2 UTSW 6 76915762 missense possibly damaging 0.86
R5041:Ctnna2 UTSW 6 76915763 missense probably damaging 1.00
R5093:Ctnna2 UTSW 6 77114929 critical splice donor site probably null
R5411:Ctnna2 UTSW 6 77114931 missense probably damaging 1.00
R5847:Ctnna2 UTSW 6 76973837 missense possibly damaging 0.87
R5874:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R5935:Ctnna2 UTSW 6 77143921 missense probably benign 0.01
R6008:Ctnna2 UTSW 6 76915828 missense probably damaging 1.00
R6115:Ctnna2 UTSW 6 77636839 missense probably benign 0.10
R6369:Ctnna2 UTSW 6 76980695 missense possibly damaging 0.88
R6490:Ctnna2 UTSW 6 77143909 missense probably benign
R7021:Ctnna2 UTSW 6 77636905 missense probably damaging 1.00
R7152:Ctnna2 UTSW 6 76980824 missense possibly damaging 0.48
R7662:Ctnna2 UTSW 6 77636869 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGATTAAGCCCACATGG -3'
(R):5'- TATTCAAAGTTAGACCAAGAGGACACC -3'

Sequencing Primer
(F):5'- GCCCACATGGTCTGAATATGC -3'
(R):5'- CCAAGAGGACACCATGGAATTTGTC -3'
Posted On2015-04-02