Incidental Mutation 'R3809:Zfp592'
ID275100
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Namezinc finger protein 592
Synonyms
MMRRC Submission 040766-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R3809 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80993681-81045164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81024532 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 415 (A415T)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
Predicted Effect probably benign
Transcript: ENSMUST00000107353
AA Change: A415T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: A415T

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176477
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
3425401B19Rik T C 14: 32,663,693 Y105C possibly damaging Het
Apol7e A T 15: 77,718,062 T287S probably benign Het
Arhgap12 A T 18: 6,037,057 N561K probably benign Het
Armc3 G T 2: 19,300,665 A757S probably damaging Het
Baz2b A T 2: 59,968,896 S295T probably benign Het
Brd4 T A 17: 32,211,270 K686N possibly damaging Het
Btnl6 T C 17: 34,508,228 T443A probably benign Het
Cacna1g T C 11: 94,416,096 T1801A probably damaging Het
Celsr2 G A 3: 108,403,239 T1509I possibly damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Cog1 G T 11: 113,655,010 M370I probably benign Het
Col6a6 C G 9: 105,780,692 V774L probably damaging Het
Csf1r T A 18: 61,112,764 S264R probably benign Het
Ctnna2 A T 6: 76,954,757 V620D probably damaging Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Frmd4b G A 6: 97,323,729 L214F possibly damaging Het
Fstl1 T A 16: 37,826,751 L161Q probably damaging Het
Hdac1 A G 4: 129,524,320 F94S probably damaging Het
Hlf T C 11: 90,388,103 D45G probably benign Het
Hps3 A T 3: 20,018,812 M501K probably damaging Het
Ighv14-4 A G 12: 114,176,554 Y79H probably damaging Het
Ip6k1 T A 9: 108,045,887 V406D probably damaging Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Itga11 A G 9: 62,771,382 T944A probably benign Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Kmt2c T C 5: 25,409,138 R195G possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Neb A G 2: 52,256,789 I2821T possibly damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr447 A T 6: 42,912,337 K271N probably damaging Het
Olfr657 A T 7: 104,636,333 I220L possibly damaging Het
Olfr918 C T 9: 38,672,863 V207I probably benign Het
Papd7 A G 13: 69,512,996 V51A probably damaging Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Pfdn1 C T 18: 36,451,092 G63D probably damaging Het
Pgghg T C 7: 140,945,295 F405L probably damaging Het
Plcd3 T C 11: 103,101,383 M50V probably null Het
Plekha8 C A 6: 54,619,349 S198R probably benign Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rnf217 T A 10: 31,503,808 I473F possibly damaging Het
Sec16a G C 2: 26,441,813 N63K possibly damaging Het
Sik3 A G 9: 46,219,486 D1240G probably benign Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc2a3 A G 6: 122,732,429 I337T probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tinag C T 9: 76,951,905 D474N probably benign Het
Ublcp1 A G 11: 44,458,282 F242L probably benign Het
Ucp1 C A 8: 83,290,641 A20D probably damaging Het
Ugt1a7c C T 1: 88,095,382 R88W possibly damaging Het
Wipf3 A G 6: 54,481,795 D45G probably damaging Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 81041548 nonsense probably null
IGL01984:Zfp592 APN 7 81038644 missense probably benign 0.00
IGL02079:Zfp592 APN 7 81039230 missense probably benign 0.20
IGL02096:Zfp592 APN 7 81025048 missense probably damaging 1.00
IGL02125:Zfp592 APN 7 81038184 missense probably benign 0.00
IGL02374:Zfp592 APN 7 81024983 missense probably damaging 1.00
IGL02419:Zfp592 APN 7 81038245 missense probably damaging 1.00
IGL02466:Zfp592 APN 7 81023998 missense probably damaging 1.00
IGL02485:Zfp592 APN 7 81037970 splice site probably benign
IGL02500:Zfp592 APN 7 81041726 missense probably benign
IGL02876:Zfp592 APN 7 81038127 missense probably benign 0.01
IGL02940:Zfp592 APN 7 81024827 missense probably damaging 1.00
R0326:Zfp592 UTSW 7 81024889 missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 81038071 missense probably damaging 1.00
R0684:Zfp592 UTSW 7 81037875 missense probably benign 0.00
R0750:Zfp592 UTSW 7 81024745 missense probably benign
R1346:Zfp592 UTSW 7 81038064 missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 81024479 missense probably damaging 0.99
R1650:Zfp592 UTSW 7 81038100 missense probably benign 0.04
R1804:Zfp592 UTSW 7 81023695 missense probably damaging 1.00
R1918:Zfp592 UTSW 7 81037420 nonsense probably null
R2114:Zfp592 UTSW 7 81024796 missense probably damaging 1.00
R2144:Zfp592 UTSW 7 81038202 missense probably benign 0.01
R2164:Zfp592 UTSW 7 81041438 missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 81041613 missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 81037411 nonsense probably null
R4574:Zfp592 UTSW 7 81023786 missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 81041859 missense probably damaging 1.00
R5023:Zfp592 UTSW 7 81024347 missense probably damaging 1.00
R5121:Zfp592 UTSW 7 81023561 missense probably damaging 1.00
R5174:Zfp592 UTSW 7 81038325 missense probably damaging 1.00
R5794:Zfp592 UTSW 7 81025033 missense probably benign 0.00
R5946:Zfp592 UTSW 7 81037897 missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 81023436 missense probably benign 0.05
R6657:Zfp592 UTSW 7 81025486 missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R6872:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R7056:Zfp592 UTSW 7 81023319 missense probably damaging 1.00
R7295:Zfp592 UTSW 7 81024322 missense probably damaging 1.00
R7351:Zfp592 UTSW 7 81041691 missense probably benign 0.00
R7475:Zfp592 UTSW 7 81023452 missense probably damaging 0.99
R7509:Zfp592 UTSW 7 81038340 missense probably damaging 0.99
R7552:Zfp592 UTSW 7 81023642 missense probably benign 0.01
R7737:Zfp592 UTSW 7 81025193 missense probably damaging 1.00
R7752:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R7901:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R8100:Zfp592 UTSW 7 81024192 missense probably benign 0.05
X0022:Zfp592 UTSW 7 81038187 nonsense probably null
X0028:Zfp592 UTSW 7 81024014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAAGCCATCTGATAGCCC -3'
(R):5'- TCAGGGCAGATCCTTTTGGG -3'

Sequencing Primer
(F):5'- ATCTGATAGCCCTCGGAGCATC -3'
(R):5'- CCTTTTGGGACCCTGGAC -3'
Posted On2015-04-02