Incidental Mutation 'R3809:Cers1'
ID275106
Institutional Source Beutler Lab
Gene Symbol Cers1
Ensembl Gene ENSMUSG00000087408
Gene Nameceramide synthase 1
SynonymsCerS1, to, Uog-1, Lass1
MMRRC Submission 040766-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R3809 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70315775-70331592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70330010 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 10 (D10G)
Ref Sequence ENSEMBL: ENSMUSP00000146749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000140239] [ENSMUST00000165819] [ENSMUST00000207684] [ENSMUST00000215817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046516
AA Change: D10G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045892
Gene: ENSMUSG00000055694
AA Change: D10G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 134 144 N/A INTRINSIC
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075666
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140239
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165819
AA Change: D10G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408
AA Change: D10G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207684
AA Change: D10G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000215817
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a ceramide synthase enzyme, which catalyzes the synthesis of ceramide, the hydrophobic moiety of sphingolipids. The encoded enzyme synthesizes 18-carbon (C18) ceramide in brain neurons. Mice lacking a functional copy of this gene exhibit impaired cerebellar development, locomotion and motor coordination. This protein is transcribed from a bicistronic mRNA, which also encodes growth differentiation factor 1. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for the spontaneous toppler mutation display reduced body and brain weight, a small cerebellum, progressive tremors, ataxia, impaired balance and seizures, as well as dramatic dendritic changes and severe loss of Purkinje cells, glial changes, and a shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
3425401B19Rik T C 14: 32,663,693 Y105C possibly damaging Het
Apol7e A T 15: 77,718,062 T287S probably benign Het
Arhgap12 A T 18: 6,037,057 N561K probably benign Het
Armc3 G T 2: 19,300,665 A757S probably damaging Het
Baz2b A T 2: 59,968,896 S295T probably benign Het
Brd4 T A 17: 32,211,270 K686N possibly damaging Het
Btnl6 T C 17: 34,508,228 T443A probably benign Het
Cacna1g T C 11: 94,416,096 T1801A probably damaging Het
Celsr2 G A 3: 108,403,239 T1509I possibly damaging Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Cog1 G T 11: 113,655,010 M370I probably benign Het
Col6a6 C G 9: 105,780,692 V774L probably damaging Het
Csf1r T A 18: 61,112,764 S264R probably benign Het
Ctnna2 A T 6: 76,954,757 V620D probably damaging Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Frmd4b G A 6: 97,323,729 L214F possibly damaging Het
Fstl1 T A 16: 37,826,751 L161Q probably damaging Het
Hdac1 A G 4: 129,524,320 F94S probably damaging Het
Hlf T C 11: 90,388,103 D45G probably benign Het
Hps3 A T 3: 20,018,812 M501K probably damaging Het
Ighv14-4 A G 12: 114,176,554 Y79H probably damaging Het
Ip6k1 T A 9: 108,045,887 V406D probably damaging Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Itga11 A G 9: 62,771,382 T944A probably benign Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Kmt2c T C 5: 25,409,138 R195G possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Neb A G 2: 52,256,789 I2821T possibly damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr447 A T 6: 42,912,337 K271N probably damaging Het
Olfr657 A T 7: 104,636,333 I220L possibly damaging Het
Olfr918 C T 9: 38,672,863 V207I probably benign Het
Papd7 A G 13: 69,512,996 V51A probably damaging Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Pfdn1 C T 18: 36,451,092 G63D probably damaging Het
Pgghg T C 7: 140,945,295 F405L probably damaging Het
Plcd3 T C 11: 103,101,383 M50V probably null Het
Plekha8 C A 6: 54,619,349 S198R probably benign Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rnf217 T A 10: 31,503,808 I473F possibly damaging Het
Sec16a G C 2: 26,441,813 N63K possibly damaging Het
Sik3 A G 9: 46,219,486 D1240G probably benign Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc2a3 A G 6: 122,732,429 I337T probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tinag C T 9: 76,951,905 D474N probably benign Het
Ublcp1 A G 11: 44,458,282 F242L probably benign Het
Ucp1 C A 8: 83,290,641 A20D probably damaging Het
Ugt1a7c C T 1: 88,095,382 R88W possibly damaging Het
Wipf3 A G 6: 54,481,795 D45G probably damaging Het
Zfp592 G A 7: 81,024,532 A415T probably benign Het
Other mutations in Cers1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Cers1 APN 8 70323233 missense probably damaging 1.00
IGL01982:Cers1 APN 8 70323431 missense probably damaging 0.99
IGL02827:Cers1 APN 8 70321527 missense probably damaging 1.00
R1025:Cers1 UTSW 8 70321536 missense probably benign 0.44
R1456:Cers1 UTSW 8 70331188 missense probably damaging 1.00
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1764:Cers1 UTSW 8 70321491 splice site probably null
R2397:Cers1 UTSW 8 70321536 missense probably benign 0.44
R3107:Cers1 UTSW 8 70322636 missense probably benign 0.30
R3808:Cers1 UTSW 8 70330010 missense possibly damaging 0.85
R4789:Cers1 UTSW 8 70323368 missense probably damaging 0.96
R5450:Cers1 UTSW 8 70318297 missense probably damaging 0.99
R5987:Cers1 UTSW 8 70321578 missense possibly damaging 0.78
R6274:Cers1 UTSW 8 70331077 missense probably damaging 1.00
R6535:Cers1 UTSW 8 70330154 missense probably damaging 1.00
R7060:Cers1 UTSW 8 70315905 missense possibly damaging 0.86
R7152:Cers1 UTSW 8 70318251 missense probably damaging 1.00
R8338:Cers1 UTSW 8 70331122 missense possibly damaging 0.92
R8371:Cers1 UTSW 8 70329573 missense probably benign
Z1176:Cers1 UTSW 8 70318318 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAGATTCAGGATGCTACCCTTCTC -3'
(R):5'- TAGTTCCTCCACGTGGCATG -3'

Sequencing Primer
(F):5'- AGCAGCTCCGCCTTTCAG -3'
(R):5'- CCACTCTGGCCTCCTGG -3'
Posted On2015-04-02