Incidental Mutation 'R3809:Kcnj12'
ID275117
Institutional Source Beutler Lab
Gene Symbol Kcnj12
Ensembl Gene ENSMUSG00000042529
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 12
SynonymsIRK2, MB-IRK2, Kir2.2
MMRRC Submission 040766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3809 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61022564-61071131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61070277 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 467 (N467S)
Ref Sequence ENSEMBL: ENSMUSP00000041696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041944] [ENSMUST00000089184] [ENSMUST00000108717]
Predicted Effect probably benign
Transcript: ENSMUST00000041944
AA Change: N467S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000041696
Gene: ENSMUSG00000042529
AA Change: N467S

DomainStartEndE-ValueType
Pfam:IRK_N 104 148 1.3e-27 PFAM
Pfam:IRK 149 476 2.5e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089184
AA Change: N365S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086588
Gene: ENSMUSG00000042529
AA Change: N365S

DomainStartEndE-ValueType
Pfam:IRK_N 2 46 1.2e-31 PFAM
Pfam:IRK 47 381 5.4e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108717
AA Change: N365S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104357
Gene: ENSMUSG00000042529
AA Change: N365S

DomainStartEndE-ValueType
Pfam:IRK_N 2 46 1.2e-31 PFAM
Pfam:IRK 47 381 5.4e-174 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inwardly rectifying K+ channel which may be blocked by divalent cations. This protein is thought to be one of multiple inwardly rectifying channels which contribute to the cardiac inward rectifier current (IK1). The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are viable and fertile with no detected abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
3425401B19Rik T C 14: 32,663,693 Y105C possibly damaging Het
Apol7e A T 15: 77,718,062 T287S probably benign Het
Arhgap12 A T 18: 6,037,057 N561K probably benign Het
Armc3 G T 2: 19,300,665 A757S probably damaging Het
Baz2b A T 2: 59,968,896 S295T probably benign Het
Brd4 T A 17: 32,211,270 K686N possibly damaging Het
Btnl6 T C 17: 34,508,228 T443A probably benign Het
Cacna1g T C 11: 94,416,096 T1801A probably damaging Het
Celsr2 G A 3: 108,403,239 T1509I possibly damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Cog1 G T 11: 113,655,010 M370I probably benign Het
Col6a6 C G 9: 105,780,692 V774L probably damaging Het
Csf1r T A 18: 61,112,764 S264R probably benign Het
Ctnna2 A T 6: 76,954,757 V620D probably damaging Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Frmd4b G A 6: 97,323,729 L214F possibly damaging Het
Fstl1 T A 16: 37,826,751 L161Q probably damaging Het
Hdac1 A G 4: 129,524,320 F94S probably damaging Het
Hlf T C 11: 90,388,103 D45G probably benign Het
Hps3 A T 3: 20,018,812 M501K probably damaging Het
Ighv14-4 A G 12: 114,176,554 Y79H probably damaging Het
Ip6k1 T A 9: 108,045,887 V406D probably damaging Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Itga11 A G 9: 62,771,382 T944A probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Kmt2c T C 5: 25,409,138 R195G possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Neb A G 2: 52,256,789 I2821T possibly damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr447 A T 6: 42,912,337 K271N probably damaging Het
Olfr657 A T 7: 104,636,333 I220L possibly damaging Het
Olfr918 C T 9: 38,672,863 V207I probably benign Het
Papd7 A G 13: 69,512,996 V51A probably damaging Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Pfdn1 C T 18: 36,451,092 G63D probably damaging Het
Pgghg T C 7: 140,945,295 F405L probably damaging Het
Plcd3 T C 11: 103,101,383 M50V probably null Het
Plekha8 C A 6: 54,619,349 S198R probably benign Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rnf217 T A 10: 31,503,808 I473F possibly damaging Het
Sec16a G C 2: 26,441,813 N63K possibly damaging Het
Sik3 A G 9: 46,219,486 D1240G probably benign Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc2a3 A G 6: 122,732,429 I337T probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tinag C T 9: 76,951,905 D474N probably benign Het
Ublcp1 A G 11: 44,458,282 F242L probably benign Het
Ucp1 C A 8: 83,290,641 A20D probably damaging Het
Ugt1a7c C T 1: 88,095,382 R88W possibly damaging Het
Wipf3 A G 6: 54,481,795 D45G probably damaging Het
Zfp592 G A 7: 81,024,532 A415T probably benign Het
Other mutations in Kcnj12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02340:Kcnj12 APN 11 61069493 missense probably benign 0.00
R0377:Kcnj12 UTSW 11 61069396 missense probably benign
R1358:Kcnj12 UTSW 11 61069887 missense probably benign 0.08
R1691:Kcnj12 UTSW 11 61070277 missense possibly damaging 0.61
R1835:Kcnj12 UTSW 11 61069557 missense possibly damaging 0.86
R3808:Kcnj12 UTSW 11 61070277 missense probably benign 0.01
R5330:Kcnj12 UTSW 11 61070186 missense probably benign 0.06
R5331:Kcnj12 UTSW 11 61070186 missense probably benign 0.06
R5777:Kcnj12 UTSW 11 61070451 missense possibly damaging 0.88
R6065:Kcnj12 UTSW 11 61069877 missense probably damaging 1.00
R6525:Kcnj12 UTSW 11 61069571 missense probably damaging 1.00
R7715:Kcnj12 UTSW 11 61066952 critical splice donor site probably null
R7969:Kcnj12 UTSW 11 61069604 nonsense probably null
R8071:Kcnj12 UTSW 11 61069999 missense probably damaging 1.00
R8517:Kcnj12 UTSW 11 61069373 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACCTTGAGACAGACGACTTTG -3'
(R):5'- AAATCTCCGACTCCCGTCTG -3'

Sequencing Primer
(F):5'- CCTTGAGACAGACGACTTTGAGATTG -3'
(R):5'- CGTCTGTAGGGCCGTTCAAG -3'
Posted On2015-04-02