Incidental Mutation 'R3809:Papd7'
ID275128
Institutional Source Beutler Lab
Gene Symbol Papd7
Ensembl Gene ENSMUSG00000034575
Gene NamePAP associated domain containing 7
SynonymsPols, LAK-1, TRF4, TRF4-1
MMRRC Submission 040766-MU
Accession Numbers

Ncbi RefSeq: NM_198600.2, NM_001169131.1; MGI: 2682295

Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R3809 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location69497959-69534617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69512996 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 51 (V51A)
Ref Sequence ENSEMBL: ENSMUSP00000152244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044081] [ENSMUST00000198607] [ENSMUST00000223344]
Predicted Effect probably damaging
Transcript: ENSMUST00000044081
AA Change: V51A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040757
Gene: ENSMUSG00000034575
AA Change: V51A

DomainStartEndE-ValueType
Pfam:NTP_transf_2 15 124 4.1e-20 PFAM
Pfam:PAP_assoc 178 238 5.4e-19 PFAM
low complexity region 343 368 N/A INTRINSIC
low complexity region 496 505 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198607
AA Change: V294A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142516
Gene: ENSMUSG00000034575
AA Change: V294A

DomainStartEndE-ValueType
low complexity region 46 98 N/A INTRINSIC
low complexity region 106 118 N/A INTRINSIC
low complexity region 122 145 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
Pfam:NTP_transf_2 258 368 1.6e-14 PFAM
Pfam:PAP_assoc 421 481 8.3e-16 PFAM
low complexity region 586 611 N/A INTRINSIC
low complexity region 739 748 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221578
Predicted Effect probably damaging
Transcript: ENSMUST00000223344
AA Change: V51A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA polymerase that is likely involved in DNA repair. In addition, the encoded protein may be required for sister chromatid adhesion. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
3425401B19Rik T C 14: 32,663,693 Y105C possibly damaging Het
Apol7e A T 15: 77,718,062 T287S probably benign Het
Arhgap12 A T 18: 6,037,057 N561K probably benign Het
Armc3 G T 2: 19,300,665 A757S probably damaging Het
Baz2b A T 2: 59,968,896 S295T probably benign Het
Brd4 T A 17: 32,211,270 K686N possibly damaging Het
Btnl6 T C 17: 34,508,228 T443A probably benign Het
Cacna1g T C 11: 94,416,096 T1801A probably damaging Het
Celsr2 G A 3: 108,403,239 T1509I possibly damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Cog1 G T 11: 113,655,010 M370I probably benign Het
Col6a6 C G 9: 105,780,692 V774L probably damaging Het
Csf1r T A 18: 61,112,764 S264R probably benign Het
Ctnna2 A T 6: 76,954,757 V620D probably damaging Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Frmd4b G A 6: 97,323,729 L214F possibly damaging Het
Fstl1 T A 16: 37,826,751 L161Q probably damaging Het
Hdac1 A G 4: 129,524,320 F94S probably damaging Het
Hlf T C 11: 90,388,103 D45G probably benign Het
Hps3 A T 3: 20,018,812 M501K probably damaging Het
Ighv14-4 A G 12: 114,176,554 Y79H probably damaging Het
Ip6k1 T A 9: 108,045,887 V406D probably damaging Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Itga11 A G 9: 62,771,382 T944A probably benign Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Kmt2c T C 5: 25,409,138 R195G possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Neb A G 2: 52,256,789 I2821T possibly damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr447 A T 6: 42,912,337 K271N probably damaging Het
Olfr657 A T 7: 104,636,333 I220L possibly damaging Het
Olfr918 C T 9: 38,672,863 V207I probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Pfdn1 C T 18: 36,451,092 G63D probably damaging Het
Pgghg T C 7: 140,945,295 F405L probably damaging Het
Plcd3 T C 11: 103,101,383 M50V probably null Het
Plekha8 C A 6: 54,619,349 S198R probably benign Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rnf217 T A 10: 31,503,808 I473F possibly damaging Het
Sec16a G C 2: 26,441,813 N63K possibly damaging Het
Sik3 A G 9: 46,219,486 D1240G probably benign Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc2a3 A G 6: 122,732,429 I337T probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tinag C T 9: 76,951,905 D474N probably benign Het
Ublcp1 A G 11: 44,458,282 F242L probably benign Het
Ucp1 C A 8: 83,290,641 A20D probably damaging Het
Ugt1a7c C T 1: 88,095,382 R88W possibly damaging Het
Wipf3 A G 6: 54,481,795 D45G probably damaging Het
Zfp592 G A 7: 81,024,532 A415T probably benign Het
Other mutations in Papd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Papd7 APN 13 69500559 missense probably benign 0.02
IGL02690:Papd7 APN 13 69510625 missense probably benign 0.01
IGL03047:Papd7 UTSW 13 69502911 missense probably damaging 1.00
P0027:Papd7 UTSW 13 69506955 nonsense probably null
R0309:Papd7 UTSW 13 69499932 missense possibly damaging 0.95
R1713:Papd7 UTSW 13 69503051 missense probably benign 0.10
R2936:Papd7 UTSW 13 69502327 missense possibly damaging 0.82
R4927:Papd7 UTSW 13 69502900 splice site probably null
R6419:Papd7 UTSW 13 69510666 missense possibly damaging 0.91
R7011:Papd7 UTSW 13 69500080 missense probably damaging 1.00
R7505:Papd7 UTSW 13 69506928 missense probably damaging 1.00
R7547:Papd7 UTSW 13 69533704 missense probably benign 0.04
R7554:Papd7 UTSW 13 69500072 missense probably damaging 1.00
R8040:Papd7 UTSW 13 69500481 missense probably damaging 0.99
R8124:Papd7 UTSW 13 69533597 unclassified probably benign
RF027:Papd7 UTSW 13 69533854 unclassified probably benign
RF039:Papd7 UTSW 13 69533854 unclassified probably benign
T0722:Papd7 UTSW 13 69506955 nonsense probably null
Z1177:Papd7 UTSW 13 69503634 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTTATACCACAAGAGGACAATC -3'
(R):5'- TGAGGCCCTTTTCACTCTGG -3'

Sequencing Primer
(F):5'- TAACCACTGTAAGAAAACCAGAGG -3'
(R):5'- GCCCTTTTCACTCTGGCTTTATATAC -3'
Posted On2015-04-02