Incidental Mutation 'R3809:3425401B19Rik'
ID275129
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission 040766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R3809 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32663693 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 105 (Y105C)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096038
AA Change: Y105C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: Y105C

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226958
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Apol7e A T 15: 77,718,062 T287S probably benign Het
Arhgap12 A T 18: 6,037,057 N561K probably benign Het
Armc3 G T 2: 19,300,665 A757S probably damaging Het
Baz2b A T 2: 59,968,896 S295T probably benign Het
Brd4 T A 17: 32,211,270 K686N possibly damaging Het
Btnl6 T C 17: 34,508,228 T443A probably benign Het
Cacna1g T C 11: 94,416,096 T1801A probably damaging Het
Celsr2 G A 3: 108,403,239 T1509I possibly damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Cog1 G T 11: 113,655,010 M370I probably benign Het
Col6a6 C G 9: 105,780,692 V774L probably damaging Het
Csf1r T A 18: 61,112,764 S264R probably benign Het
Ctnna2 A T 6: 76,954,757 V620D probably damaging Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Frmd4b G A 6: 97,323,729 L214F possibly damaging Het
Fstl1 T A 16: 37,826,751 L161Q probably damaging Het
Hdac1 A G 4: 129,524,320 F94S probably damaging Het
Hlf T C 11: 90,388,103 D45G probably benign Het
Hps3 A T 3: 20,018,812 M501K probably damaging Het
Ighv14-4 A G 12: 114,176,554 Y79H probably damaging Het
Ip6k1 T A 9: 108,045,887 V406D probably damaging Het
Iqcf1 T C 9: 106,501,878 S29P possibly damaging Het
Itga11 A G 9: 62,771,382 T944A probably benign Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Kmt2c T C 5: 25,409,138 R195G possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Neb A G 2: 52,256,789 I2821T possibly damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr447 A T 6: 42,912,337 K271N probably damaging Het
Olfr657 A T 7: 104,636,333 I220L possibly damaging Het
Olfr918 C T 9: 38,672,863 V207I probably benign Het
Papd7 A G 13: 69,512,996 V51A probably damaging Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Pfdn1 C T 18: 36,451,092 G63D probably damaging Het
Pgghg T C 7: 140,945,295 F405L probably damaging Het
Plcd3 T C 11: 103,101,383 M50V probably null Het
Plekha8 C A 6: 54,619,349 S198R probably benign Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rnf217 T A 10: 31,503,808 I473F possibly damaging Het
Sec16a G C 2: 26,441,813 N63K possibly damaging Het
Sik3 A G 9: 46,219,486 D1240G probably benign Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc2a3 A G 6: 122,732,429 I337T probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tinag C T 9: 76,951,905 D474N probably benign Het
Ublcp1 A G 11: 44,458,282 F242L probably benign Het
Ucp1 C A 8: 83,290,641 A20D probably damaging Het
Ugt1a7c C T 1: 88,095,382 R88W possibly damaging Het
Wipf3 A G 6: 54,481,795 D45G probably damaging Het
Zfp592 G A 7: 81,024,532 A415T probably benign Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32662632 missense probably benign 0.03
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAGTTGACACCACTTTCTGGG -3'
(R):5'- TTCCATGACTCTGACCTGGC -3'

Sequencing Primer
(F):5'- CACTTTCTGGGGGATGTGCAAAC -3'
(R):5'- GACTCTGACCTGGCCCTGTC -3'
Posted On2015-04-02