Incidental Mutation 'R3810:Rbbp5'
ID275140
Institutional Source Beutler Lab
Gene Symbol Rbbp5
Ensembl Gene ENSMUSG00000026439
Gene Nameretinoblastoma binding protein 5, histone lysine methyltransferase complex subunit
Synonyms4933411J24Rik
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132477365-132505659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132492587 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000027700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027700] [ENSMUST00000187505] [ENSMUST00000188575] [ENSMUST00000189786] [ENSMUST00000190825] [ENSMUST00000190997]
PDB Structure
WDR5 IN COMPLEX WITH AN RBBP5 PEPTIDE RECRUITED TO NOVEL SITE [X-RAY DIFFRACTION]
WDR5 IN COMPLEX WITH AN RBBP5 PEPTIDE AND HISTONE H3 PEPTIDE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027700
AA Change: V59A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027700
Gene: ENSMUSG00000026439
AA Change: V59A

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187505
AA Change: V59A

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141176
Gene: ENSMUSG00000026439
AA Change: V59A

DomainStartEndE-ValueType
Blast:WD40 1 52 9e-13 BLAST
WD40 55 99 5.1e-3 SMART
WD40 114 153 7.9e-2 SMART
WD40 156 195 1.9e-2 SMART
low complexity region 217 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188575
SMART Domains Protein: ENSMUSP00000140344
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
Blast:WD40 14 55 9e-9 BLAST
SCOP:d1gxra_ 34 87 8e-8 SMART
Blast:WD40 58 107 8e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189786
SMART Domains Protein: ENSMUSP00000140790
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 1 27 1.2e0 SMART
WD40 30 69 4.6e-9 SMART
Blast:WD40 72 149 2e-32 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000190825
AA Change: V186A

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139519
Gene: ENSMUSG00000026439
AA Change: V186A

DomainStartEndE-ValueType
WD40 14 52 1.4e-3 SMART
WD40 55 94 4.6e-9 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 5.1e-3 SMART
WD40 241 280 7.9e-2 SMART
WD40 283 322 1.9e-2 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190997
AA Change: V186A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141003
Gene: ENSMUSG00000026439
AA Change: V186A

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Meta Mutation Damage Score 0.1089 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed nuclear protein which belongs to a highly conserved subfamily of WD-repeat proteins. The encoded protein binds directly to retinoblastoma protein, which regulates cell proliferation. It interacts preferentially with the underphosphorylated retinoblastoma protein via the E1A-binding pocket B. Three alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Rbbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Rbbp5 APN 1 132489706 missense probably damaging 1.00
IGL01373:Rbbp5 APN 1 132492601 missense probably benign 0.07
IGL01577:Rbbp5 APN 1 132492655 missense possibly damaging 0.68
IGL01728:Rbbp5 APN 1 132498080 missense probably benign
R0097:Rbbp5 UTSW 1 132490489 missense possibly damaging 0.81
R0420:Rbbp5 UTSW 1 132493844 missense possibly damaging 0.88
R1540:Rbbp5 UTSW 1 132494282 nonsense probably null
R1965:Rbbp5 UTSW 1 132494297 missense probably damaging 1.00
R2419:Rbbp5 UTSW 1 132493826 missense possibly damaging 0.95
R2924:Rbbp5 UTSW 1 132492663 critical splice donor site probably null
R3811:Rbbp5 UTSW 1 132492587 missense probably damaging 0.98
R4234:Rbbp5 UTSW 1 132484758 missense probably benign 0.08
R5024:Rbbp5 UTSW 1 132490488 missense possibly damaging 0.65
R5166:Rbbp5 UTSW 1 132490565 missense possibly damaging 0.60
R5435:Rbbp5 UTSW 1 132494275 missense probably damaging 1.00
R6018:Rbbp5 UTSW 1 132494340 missense probably damaging 1.00
R6172:Rbbp5 UTSW 1 132496816 missense possibly damaging 0.89
R7500:Rbbp5 UTSW 1 132494141 missense probably benign 0.35
X0019:Rbbp5 UTSW 1 132489698 missense probably damaging 1.00
X0025:Rbbp5 UTSW 1 132489658 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCTATGTGTCGTCACTAGT -3'
(R):5'- TAAGGCCGCACTGACACCT -3'

Sequencing Primer
(F):5'- ATGTGTCGTCACTAGTTTGTTTCCAC -3'
(R):5'- AGTGCCATTATCTCTGCACTCAGG -3'
Posted On2015-04-02