Incidental Mutation 'R3810:Olfr1152'
ID275145
Institutional Source Beutler Lab
Gene Symbol Olfr1152
Ensembl Gene ENSMUSG00000045225
Gene Nameolfactory receptor 1152
SynonymsMOR177-12, GA_x6K02T2Q125-49372426-49373358
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87866492-87874156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87868401 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 137 (S137T)
Ref Sequence ENSEMBL: ENSMUSP00000151045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051058] [ENSMUST00000213308]
Predicted Effect probably damaging
Transcript: ENSMUST00000051058
AA Change: S137T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054645
Gene: ENSMUSG00000045225
AA Change: S137T

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4e-46 PFAM
Pfam:7tm_1 40 290 1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121994
Predicted Effect probably damaging
Transcript: ENSMUST00000213308
AA Change: S137T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Olfr1152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01418:Olfr1152 APN 2 87868465 missense probably benign 0.00
IGL01618:Olfr1152 APN 2 87868144 missense probably damaging 0.96
IGL02326:Olfr1152 APN 2 87868675 missense probably damaging 1.00
IGL03162:Olfr1152 APN 2 87868140 missense probably benign 0.00
IGL03189:Olfr1152 APN 2 87868215 missense possibly damaging 0.76
I2288:Olfr1152 UTSW 2 87868135 missense probably damaging 1.00
R0761:Olfr1152 UTSW 2 87868536 missense possibly damaging 0.88
R1558:Olfr1152 UTSW 2 87868115 missense probably damaging 1.00
R1938:Olfr1152 UTSW 2 87868461 missense probably benign 0.01
R3812:Olfr1152 UTSW 2 87868401 missense probably damaging 1.00
R4728:Olfr1152 UTSW 2 87868435 missense probably benign 0.13
R4928:Olfr1152 UTSW 2 87868230 missense probably benign 0.32
R5172:Olfr1152 UTSW 2 87868827 missense probably benign 0.20
R5174:Olfr1152 UTSW 2 87868411 missense possibly damaging 0.79
R6147:Olfr1152 UTSW 2 87868717 missense probably benign 0.03
R6195:Olfr1152 UTSW 2 87868560 missense possibly damaging 0.63
R6233:Olfr1152 UTSW 2 87868560 missense possibly damaging 0.63
R6541:Olfr1152 UTSW 2 87868294 missense probably benign 0.11
R7507:Olfr1152 UTSW 2 87868369 missense probably damaging 1.00
R8068:Olfr1152 UTSW 2 87868651 missense not run
Predicted Primers PCR Primer
(F):5'- AGATGTTATTGGACCTGCTTGC -3'
(R):5'- TGAGATGGTGCTCAGTTCAATG -3'

Sequencing Primer
(F):5'- ATTGGACCTGCTTGCCAAGAG -3'
(R):5'- GGTGCTCAGTTCAATGAAACC -3'
Posted On2015-04-02