Incidental Mutation 'R3810:Olfr1255'
ID275147
Institutional Source Beutler Lab
Gene Symbol Olfr1255
Ensembl Gene ENSMUSG00000045148
Gene Nameolfactory receptor 1255
SynonymsGA_x6K02T2Q125-51257221-51258135, MOR232-4
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89812051-89817860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89817051 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 242 (S242T)
Ref Sequence ENSEMBL: ENSMUSP00000060602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057369] [ENSMUST00000214508]
Predicted Effect probably damaging
Transcript: ENSMUST00000057369
AA Change: S242T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060602
Gene: ENSMUSG00000045148
AA Change: S242T

DomainStartEndE-ValueType
Pfam:7tm_4 35 309 5.2e-44 PFAM
Pfam:7tm_1 45 291 4.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214508
AA Change: S236T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1550 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Olfr1255
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Olfr1255 APN 2 89816673 missense probably damaging 1.00
IGL02902:Olfr1255 APN 2 89817164 nonsense probably null
IGL03077:Olfr1255 APN 2 89817142 missense probably damaging 1.00
IGL03087:Olfr1255 APN 2 89816671 missense probably damaging 1.00
IGL03371:Olfr1255 APN 2 89817165 missense possibly damaging 0.64
R0683:Olfr1255 UTSW 2 89817178 missense probably damaging 1.00
R1428:Olfr1255 UTSW 2 89816381 missense probably damaging 1.00
R1567:Olfr1255 UTSW 2 89817184 missense probably damaging 1.00
R3812:Olfr1255 UTSW 2 89817051 missense probably damaging 1.00
R4900:Olfr1255 UTSW 2 89816968 missense possibly damaging 0.58
R5538:Olfr1255 UTSW 2 89816620 missense probably damaging 1.00
R5770:Olfr1255 UTSW 2 89816549 missense probably damaging 1.00
R5894:Olfr1255 UTSW 2 89817213 missense possibly damaging 0.59
R5942:Olfr1255 UTSW 2 89816340 nonsense probably null
R6263:Olfr1255 UTSW 2 89816760 missense probably damaging 1.00
R6271:Olfr1255 UTSW 2 89816562 missense probably damaging 0.99
R6651:Olfr1255 UTSW 2 89816896 missense probably benign 0.13
R7298:Olfr1255 UTSW 2 89816521 missense probably damaging 0.98
R7379:Olfr1255 UTSW 2 89816689 missense probably benign 0.00
R7465:Olfr1255 UTSW 2 89816536 missense probably damaging 1.00
R7546:Olfr1255 UTSW 2 89817019 missense probably benign 0.00
R7546:Olfr1255 UTSW 2 89817194 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGTACCCATTGTTGGAACTTG -3'
(R):5'- TGTATGTAATGTTCAAAGGTCCCTG -3'

Sequencing Primer
(F):5'- GGAACTTGTTTGCATGGACACAC -3'
(R):5'- TCCTCCAGAGCTTCTTTATTGC -3'
Posted On2015-04-02