Incidental Mutation 'R3810:Trpc4ap'
ID275150
Institutional Source Beutler Lab
Gene Symbol Trpc4ap
Ensembl Gene ENSMUSG00000038324
Gene Nametransient receptor potential cation channel, subfamily C, member 4 associated protein
SynonymsD2Ertd113e, Trrp4ap, 4833429F06Rik, Trp4-associated protein TAP1
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155634271-155692384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155643435 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 448 (I448F)
Ref Sequence ENSEMBL: ENSMUSP00000099429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000103140]
Predicted Effect probably damaging
Transcript: ENSMUST00000041059
AA Change: I456F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324
AA Change: I456F

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 407 714 5.2e-135 PFAM
low complexity region 724 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103140
AA Change: I448F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324
AA Change: I448F

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 399 710 1.1e-138 PFAM
low complexity region 716 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152548
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Trpc4ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Trpc4ap APN 2 155639535 missense possibly damaging 0.90
IGL02149:Trpc4ap APN 2 155639547 missense probably damaging 0.97
IGL02313:Trpc4ap APN 2 155650468 missense probably damaging 1.00
IGL02408:Trpc4ap APN 2 155671069 missense possibly damaging 0.71
R0057:Trpc4ap UTSW 2 155640486 missense possibly damaging 0.94
R0057:Trpc4ap UTSW 2 155640486 missense possibly damaging 0.94
R0255:Trpc4ap UTSW 2 155657946 splice site probably benign
R0306:Trpc4ap UTSW 2 155636260 missense probably benign 0.37
R0382:Trpc4ap UTSW 2 155636230 missense probably damaging 1.00
R0525:Trpc4ap UTSW 2 155640478 missense possibly damaging 0.85
R1184:Trpc4ap UTSW 2 155645070 splice site probably benign
R1711:Trpc4ap UTSW 2 155657744 missense probably benign 0.01
R2113:Trpc4ap UTSW 2 155657936 missense probably damaging 0.99
R4384:Trpc4ap UTSW 2 155640507 missense possibly damaging 0.85
R4664:Trpc4ap UTSW 2 155672997 missense probably benign 0.04
R4690:Trpc4ap UTSW 2 155635133 missense probably damaging 0.97
R5347:Trpc4ap UTSW 2 155672988 critical splice donor site probably null
R5655:Trpc4ap UTSW 2 155653627 missense possibly damaging 0.95
R5689:Trpc4ap UTSW 2 155671035 splice site probably null
R5828:Trpc4ap UTSW 2 155635210 intron probably benign
R5894:Trpc4ap UTSW 2 155666213 missense probably benign 0.11
R6056:Trpc4ap UTSW 2 155671074 missense probably damaging 1.00
R6289:Trpc4ap UTSW 2 155663707 missense possibly damaging 0.90
R6539:Trpc4ap UTSW 2 155636258 missense probably benign 0.00
R6682:Trpc4ap UTSW 2 155637767 critical splice acceptor site probably null
R7022:Trpc4ap UTSW 2 155657822 missense probably benign 0.01
R7031:Trpc4ap UTSW 2 155692215 missense unknown
X0018:Trpc4ap UTSW 2 155653564 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTCAACCTACAGGGCTGAG -3'
(R):5'- CAGCCATGAAGGTCTGACTTTTCC -3'

Sequencing Primer
(F):5'- GGAGCACAGCCTCACAGATATTG -3'
(R):5'- GAAGGTCTGACTTTTCCACTAAAG -3'
Posted On2015-04-02