Incidental Mutation 'R3810:Ctbp1'
ID275152
Institutional Source Beutler Lab
Gene Symbol Ctbp1
Ensembl Gene ENSMUSG00000037373
Gene NameC-terminal binding protein 1
SynonymsD5H4S115, BARS, D4S115h, CtBP3/BARS, D5H4S115E, CtBP1-L, CtBP1-S
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R3810 (G1)
Quality Score105
Status Validated
Chromosome5
Chromosomal Location33247723-33274994 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 33267045 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079746] [ENSMUST00000200899] [ENSMUST00000201275] [ENSMUST00000201372] [ENSMUST00000201575] [ENSMUST00000202190] [ENSMUST00000202820] [ENSMUST00000202868] [ENSMUST00000202962]
Predicted Effect probably benign
Transcript: ENSMUST00000079746
SMART Domains Protein: ENSMUSP00000078682
Gene: ENSMUSG00000037373

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 30 352 3.3e-31 PFAM
Pfam:2-Hacid_dh_C 133 317 8.5e-58 PFAM
Pfam:NAD_binding_2 174 291 9e-7 PFAM
low complexity region 413 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200899
SMART Domains Protein: ENSMUSP00000144672
Gene: ENSMUSG00000037373

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 19 85 7.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201275
SMART Domains Protein: ENSMUSP00000144029
Gene: ENSMUSG00000037373

DomainStartEndE-ValueType
PDB:2HU2|A 1 54 5e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201372
SMART Domains Protein: ENSMUSP00000143877
Gene: ENSMUSG00000037373

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 1 102 2.2e-17 PFAM
Pfam:2-Hacid_dh_C 59 180 3.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201575
SMART Domains Protein: ENSMUSP00000144554
Gene: ENSMUSG00000037373

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 1 278 6.7e-22 PFAM
Pfam:2-Hacid_dh_C 59 243 6.4e-56 PFAM
Pfam:NAD_binding_2 100 217 2.5e-5 PFAM
low complexity region 339 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202632
Predicted Effect probably benign
Transcript: ENSMUST00000202820
SMART Domains Protein: ENSMUSP00000144303
Gene: ENSMUSG00000037373

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 19 117 2.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202868
SMART Domains Protein: ENSMUSP00000144024
Gene: ENSMUSG00000037373

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 19 341 3.5e-31 PFAM
Pfam:2-Hacid_dh_C 122 306 8.6e-58 PFAM
Pfam:NAD_binding_2 163 280 3.8e-7 PFAM
low complexity region 401 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202962
SMART Domains Protein: ENSMUSP00000144251
Gene: ENSMUSG00000037373

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 19 269 3.3e-24 PFAM
Pfam:2-Hacid_dh_C 122 303 4.1e-51 PFAM
Pfam:NAD_binding_2 163 280 2.1e-5 PFAM
low complexity region 310 327 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the C-terminus of adenovirus E1A proteins. This phosphoprotein is a transcriptional repressor and may play a role during cellular proliferation. This protein and the product of a second closely related gene, CTBP2, can dimerize. Both proteins can also interact with a polycomb group protein complex which participates in regulation of gene expression during development. Alternative splicing of transcripts from this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial postnatal lethality and decreased body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Ctbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Ctbp1 APN 5 33259133 splice site probably null
IGL02109:Ctbp1 APN 5 33266968 missense probably damaging 0.99
interminable UTSW 5 33259245 missense possibly damaging 0.57
Terminal UTSW 5 33250860 nonsense probably null
R0282:Ctbp1 UTSW 5 33250856 critical splice donor site probably null
R1445:Ctbp1 UTSW 5 33261063 missense probably benign 0.01
R1988:Ctbp1 UTSW 5 33250904 missense possibly damaging 0.93
R2008:Ctbp1 UTSW 5 33250986 missense probably damaging 1.00
R4175:Ctbp1 UTSW 5 33266906 missense probably damaging 1.00
R4461:Ctbp1 UTSW 5 33251013 missense probably damaging 1.00
R4494:Ctbp1 UTSW 5 33250869 missense possibly damaging 0.67
R5381:Ctbp1 UTSW 5 33249690 missense probably benign 0.00
R6542:Ctbp1 UTSW 5 33269571 start gained probably benign
R6764:Ctbp1 UTSW 5 33259245 missense possibly damaging 0.57
R6770:Ctbp1 UTSW 5 33250860 nonsense probably null
R7354:Ctbp1 UTSW 5 33250388 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACATATGACACTACCTTCTCATGG -3'
(R):5'- AGCTCCTATGCTCTTGAGGG -3'

Sequencing Primer
(F):5'- CTCATGGATCTCCTGTGTGGAC -3'
(R):5'- GGTCTGAATCTACTCAGTCATCAG -3'
Posted On2015-04-02