Incidental Mutation 'R3810:Ahcyl2'
ID275154
Institutional Source Beutler Lab
Gene Symbol Ahcyl2
Ensembl Gene ENSMUSG00000029772
Gene NameS-adenosylhomocysteine hydrolase-like 2
Synonyms
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R3810 (G1)
Quality Score220
Status Validated
Chromosome6
Chromosomal Location29768011-29912310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29891261 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 455 (I455V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064872] [ENSMUST00000102995] [ENSMUST00000115238] [ENSMUST00000115242] [ENSMUST00000125911]
Predicted Effect probably benign
Transcript: ENSMUST00000064872
AA Change: I320V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067638
Gene: ENSMUSG00000029772
AA Change: I320V

DomainStartEndE-ValueType
low complexity region 38 68 N/A INTRINSIC
AdoHcyase 82 507 4.47e-268 SMART
AdoHcyase_NAD 267 428 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102995
AA Change: I424V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000100060
Gene: ENSMUSG00000029772
AA Change: I424V

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 142 172 N/A INTRINSIC
AdoHcyase 186 611 4.47e-268 SMART
AdoHcyase_NAD 371 532 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115238
AA Change: I320V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110893
Gene: ENSMUSG00000029772
AA Change: I320V

DomainStartEndE-ValueType
low complexity region 38 68 N/A INTRINSIC
AdoHcyase 82 507 4.47e-268 SMART
AdoHcyase_NAD 267 428 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115242
AA Change: I425V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110897
Gene: ENSMUSG00000029772
AA Change: I425V

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 143 173 N/A INTRINSIC
AdoHcyase 187 612 4.47e-268 SMART
AdoHcyase_NAD 372 533 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125911
AA Change: I216V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135518
Gene: ENSMUSG00000029772
AA Change: I216V

DomainStartEndE-ValueType
AdoHcyase 1 403 8.07e-243 SMART
AdoHcyase_NAD 163 324 2.21e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149816
Predicted Effect probably benign
Transcript: ENSMUST00000166718
AA Change: I455V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133136
Gene: ENSMUSG00000029772
AA Change: I455V

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 20 48 N/A INTRINSIC
low complexity region 65 110 N/A INTRINSIC
low complexity region 173 203 N/A INTRINSIC
AdoHcyase 217 642 4.47e-268 SMART
AdoHcyase_NAD 402 563 2.21e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201020
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer and may be involved in the conversion of S-adenosyl-L-homocysteine to L-homocysteine and adenosine. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Ahcyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Ahcyl2 APN 6 29880557 missense probably benign 0.03
IGL03072:Ahcyl2 APN 6 29906501 splice site probably benign
IGL03195:Ahcyl2 APN 6 29906769 splice site probably benign
R0189:Ahcyl2 UTSW 6 29891243 missense probably benign 0.32
R0395:Ahcyl2 UTSW 6 29886168 missense probably damaging 1.00
R0555:Ahcyl2 UTSW 6 29890671 critical splice acceptor site probably benign
R0924:Ahcyl2 UTSW 6 29870628 unclassified probably null
R0930:Ahcyl2 UTSW 6 29870628 unclassified probably null
R1413:Ahcyl2 UTSW 6 29768587 utr 5 prime probably benign
R1446:Ahcyl2 UTSW 6 29891240 missense probably damaging 0.96
R1822:Ahcyl2 UTSW 6 29768584 utr 5 prime probably benign
R1864:Ahcyl2 UTSW 6 29908355 missense probably damaging 1.00
R1865:Ahcyl2 UTSW 6 29908355 missense probably damaging 1.00
R4429:Ahcyl2 UTSW 6 29894875 missense probably damaging 1.00
R4932:Ahcyl2 UTSW 6 29890701 missense probably benign 0.22
R5019:Ahcyl2 UTSW 6 29859739 missense possibly damaging 0.96
R5032:Ahcyl2 UTSW 6 29768556 utr 5 prime probably benign
R5396:Ahcyl2 UTSW 6 29859698 intron probably benign
R5604:Ahcyl2 UTSW 6 29908367 missense probably damaging 1.00
R5817:Ahcyl2 UTSW 6 29890721 missense probably damaging 1.00
R5959:Ahcyl2 UTSW 6 29886174 missense probably damaging 1.00
R6159:Ahcyl2 UTSW 6 29908458 missense possibly damaging 0.81
R6531:Ahcyl2 UTSW 6 29886162 missense probably benign 0.41
R7025:Ahcyl2 UTSW 6 29908421 missense probably damaging 1.00
R7478:Ahcyl2 UTSW 6 29903267 missense probably damaging 1.00
R7560:Ahcyl2 UTSW 6 29886140 missense probably damaging 1.00
R7604:Ahcyl2 UTSW 6 29768556 missense unknown
R8046:Ahcyl2 UTSW 6 29878620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATGAATGTGCCAAGCAGG -3'
(R):5'- TTTGCAAGACAGCAGCTCAG -3'

Sequencing Primer
(F):5'- GGTTTTTCCCGAGCATGAGTCTAC -3'
(R):5'- ACAGCAGCTCAGAGTTCCCTTG -3'
Posted On2015-04-02