Incidental Mutation 'R3810:Tas2r130'
ID275156
Institutional Source Beutler Lab
Gene Symbol Tas2r130
Ensembl Gene ENSMUSG00000054497
Gene Nametaste receptor, type 2, member 130
SynonymsT2R30, mt2r42, STC 7-4, Tas2r30
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location131629823-131630912 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 131630829 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000063954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067597]
Predicted Effect probably null
Transcript: ENSMUST00000067597
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063954
Gene: ENSMUSG00000054497
AA Change: M1T

DomainStartEndE-ValueType
Pfam:TAS2R 1 304 1.7e-110 PFAM
Meta Mutation Damage Score 0.9550 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Tas2r130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Tas2r130 APN 6 131630271 missense probably damaging 1.00
IGL01412:Tas2r130 APN 6 131630510 nonsense probably null
IGL01554:Tas2r130 APN 6 131630083 missense probably benign 0.44
IGL01789:Tas2r130 APN 6 131630155 missense probably damaging 1.00
R1552:Tas2r130 UTSW 6 131630167 missense probably benign 0.00
R1848:Tas2r130 UTSW 6 131630597 missense probably benign 0.00
R2020:Tas2r130 UTSW 6 131630769 missense probably damaging 1.00
R2060:Tas2r130 UTSW 6 131630817 missense probably benign 0.00
R2518:Tas2r130 UTSW 6 131630073 missense probably damaging 0.98
R5666:Tas2r130 UTSW 6 131630379 missense possibly damaging 0.82
R6225:Tas2r130 UTSW 6 131630584 small deletion probably benign
R7180:Tas2r130 UTSW 6 131630248 missense probably benign 0.00
R7284:Tas2r130 UTSW 6 131630307 missense probably benign 0.02
R7385:Tas2r130 UTSW 6 131630263 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACAAATTCTGGACATGGCC -3'
(R):5'- TGGACATACAATATCCAGGCTAAG -3'

Sequencing Primer
(F):5'- AATTCTGGACATGGCCACACTTG -3'
(R):5'- ATATCCAGGCTAAGGATTGCC -3'
Posted On2015-04-02