Incidental Mutation 'R3810:Mrgpra9'
ID275157
Institutional Source Beutler Lab
Gene Symbol Mrgpra9
Ensembl Gene ENSMUSG00000074111
Gene NameMAS-related GPR, member A9
SynonymsEG668725, MrgA9
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location47234861-47252848 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47235779 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 47 (I47F)
Ref Sequence ENSEMBL: ENSMUSP00000136396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098436] [ENSMUST00000179005]
Predicted Effect probably damaging
Transcript: ENSMUST00000098436
AA Change: I46F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096035
Gene: ENSMUSG00000074111
AA Change: I46F

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Pfam:7tm_1 56 225 1.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179005
AA Change: I47F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136396
Gene: ENSMUSG00000074111
AA Change: I47F

DomainStartEndE-ValueType
Pfam:7tm_1 12 178 3.4e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Mrgpra9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mrgpra9 APN 7 47235091 missense possibly damaging 0.85
IGL00575:Mrgpra9 APN 7 47235305 missense possibly damaging 0.76
IGL01649:Mrgpra9 APN 7 47235152 missense probably benign 0.22
IGL03207:Mrgpra9 APN 7 47235637 missense possibly damaging 0.68
R0388:Mrgpra9 UTSW 7 47252794 start codon destroyed probably null 0.08
R0972:Mrgpra9 UTSW 7 47235455 missense probably damaging 0.99
R1270:Mrgpra9 UTSW 7 47252783 critical splice donor site probably null
R1381:Mrgpra9 UTSW 7 47235302 missense possibly damaging 0.75
R1403:Mrgpra9 UTSW 7 47235638 missense probably benign 0.24
R1403:Mrgpra9 UTSW 7 47235638 missense probably benign 0.24
R1448:Mrgpra9 UTSW 7 47235813 missense probably benign 0.02
R2045:Mrgpra9 UTSW 7 47235835 missense probably benign
R2144:Mrgpra9 UTSW 7 47235463 missense probably benign 0.31
R2187:Mrgpra9 UTSW 7 47235049 missense probably damaging 1.00
R2507:Mrgpra9 UTSW 7 47235494 missense possibly damaging 0.63
R2913:Mrgpra9 UTSW 7 47235080 missense probably benign
R4177:Mrgpra9 UTSW 7 47235554 missense probably damaging 1.00
R4521:Mrgpra9 UTSW 7 47235190 missense probably damaging 1.00
R4781:Mrgpra9 UTSW 7 47235047 missense possibly damaging 0.88
R4926:Mrgpra9 UTSW 7 47235011 missense possibly damaging 0.62
R6469:Mrgpra9 UTSW 7 47235106 missense probably benign 0.02
R6505:Mrgpra9 UTSW 7 47235136 missense probably benign 0.00
R6724:Mrgpra9 UTSW 7 47235038 missense probably damaging 1.00
R7398:Mrgpra9 UTSW 7 47235637 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CACATGACAGTTGATGTGTGTTCTG -3'
(R):5'- GTTGTATTCATAGTGAAGGCCTC -3'

Sequencing Primer
(F):5'- CTGCGATGTAGAGAATCACCCTG -3'
(R):5'- GTATTCATAGTGAAGGCCTCATTTC -3'
Posted On2015-04-02