Incidental Mutation 'R3810:Uvrag'
ID275158
Institutional Source Beutler Lab
Gene Symbol Uvrag
Ensembl Gene ENSMUSG00000035354
Gene NameUV radiation resistance associated gene
Synonyms9530039D02Rik, Uvragl
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location98885021-99141141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98979712 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 383 (Y383H)
Ref Sequence ENSEMBL: ENSMUSP00000045297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037968]
Predicted Effect probably damaging
Transcript: ENSMUST00000037968
AA Change: Y383H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045297
Gene: ENSMUSG00000035354
AA Change: Y383H

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
C2 42 147 1.43e-2 SMART
Pfam:Atg14 183 469 4.9e-21 PFAM
low complexity region 546 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208609
Predicted Effect probably benign
Transcript: ENSMUST00000209123
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene complements the ultraviolet sensitivity of xeroderma pigmentosum group C cells and encodes a protein with a C2 domain. The protein activates the Beclin1-PI(3)KC3 complex, promoting autophagy and suppressing the proliferation and tumorigenicity of human colon cancer cells. Chromosomal aberrations involving this gene are associated with left-right axis malformation and mutations in this gene have been associated with colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transposon induced knock-out allele are viable and fertile but exhibit impaired autophagic flux, autophagosome accumulation in the heart, and age-related cardiomyopathy associated with compromised cardiac function and heart inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Uvrag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Uvrag APN 7 98979741 missense probably damaging 0.99
IGL01085:Uvrag APN 7 99118224 missense probably damaging 1.00
IGL01362:Uvrag APN 7 98888513 missense probably benign 0.03
IGL01510:Uvrag APN 7 99004589 nonsense probably null
IGL02016:Uvrag APN 7 99099442 missense probably benign 0.06
IGL02164:Uvrag APN 7 99004689 nonsense probably null
IGL02170:Uvrag APN 7 99109090 nonsense probably null
IGL02836:Uvrag APN 7 98979777 missense possibly damaging 0.83
IGL02963:Uvrag APN 7 98906490 critical splice donor site probably null
PIT4651001:Uvrag UTSW 7 98906520 missense probably benign 0.23
R0016:Uvrag UTSW 7 98991981 missense probably benign 0.01
R0016:Uvrag UTSW 7 98991981 missense probably benign 0.01
R0304:Uvrag UTSW 7 98887973 missense probably benign 0.03
R0394:Uvrag UTSW 7 99004719 splice site probably benign
R0561:Uvrag UTSW 7 98888561 missense probably damaging 0.96
R1398:Uvrag UTSW 7 99065820 nonsense probably null
R1646:Uvrag UTSW 7 99118224 missense probably damaging 1.00
R1692:Uvrag UTSW 7 99004663 missense probably benign 0.02
R1760:Uvrag UTSW 7 98888348 missense probably benign 0.03
R1767:Uvrag UTSW 7 99099394 missense probably damaging 0.98
R2011:Uvrag UTSW 7 98939889 critical splice donor site probably null
R2484:Uvrag UTSW 7 98888461 missense probably benign 0.00
R3684:Uvrag UTSW 7 98988220 missense probably damaging 1.00
R3698:Uvrag UTSW 7 98939943 missense probably damaging 1.00
R3766:Uvrag UTSW 7 98888143 nonsense probably null
R4703:Uvrag UTSW 7 98989587 missense probably damaging 1.00
R5853:Uvrag UTSW 7 98888077 missense possibly damaging 0.80
R5896:Uvrag UTSW 7 98988207 nonsense probably null
R6185:Uvrag UTSW 7 99140832 critical splice donor site probably null
R6248:Uvrag UTSW 7 98988191 missense probably damaging 0.99
R6457:Uvrag UTSW 7 98906519 missense probably damaging 1.00
R6812:Uvrag UTSW 7 98888482 missense probably benign
R7451:Uvrag UTSW 7 99140913 missense unknown
R7724:Uvrag UTSW 7 98991963 missense probably benign 0.06
R7769:Uvrag UTSW 7 98979721 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCCTCCATTAGACGACACTTC -3'
(R):5'- AGTAGGTGCAGTTTCAAGCC -3'

Sequencing Primer
(F):5'- AGACGACACTTCATCTTTCCAG -3'
(R):5'- GGTGCAGTTTCAAGCCTTATTAATG -3'
Posted On2015-04-02