Incidental Mutation 'R3810:Klhl35'
ID275159
Institutional Source Beutler Lab
Gene Symbol Klhl35
Ensembl Gene ENSMUSG00000035298
Gene Namekelch-like 35
Synonyms
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99466004-99474022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99470241 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 311 (D311G)
Ref Sequence ENSEMBL: ENSMUSP00000041363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037359] [ENSMUST00000152424]
Predicted Effect probably benign
Transcript: ENSMUST00000037359
AA Change: D311G

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041363
Gene: ENSMUSG00000035298
AA Change: D311G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
BTB 40 141 5.82e-17 SMART
BACK 146 248 1.21e-27 SMART
Kelch 292 341 6.32e-2 SMART
Kelch 342 385 1.18e-5 SMART
Kelch 386 432 3.01e-12 SMART
Kelch 433 480 2.23e-1 SMART
Kelch 481 522 2.71e-5 SMART
Kelch 523 570 1.39e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142339
Predicted Effect probably benign
Transcript: ENSMUST00000152424
SMART Domains Protein: ENSMUSP00000120346
Gene: ENSMUSG00000035298

DomainStartEndE-ValueType
Pfam:Kelch_1 1 34 1.1e-8 PFAM
Pfam:Kelch_6 36 79 3.6e-8 PFAM
Pfam:Kelch_1 38 76 2.6e-7 PFAM
low complexity region 106 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153736
Meta Mutation Damage Score 0.1000 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Klhl35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Klhl35 APN 7 99471681 splice site probably benign
IGL03003:Klhl35 APN 7 99470343 missense probably damaging 0.98
R0268:Klhl35 UTSW 7 99471751 missense probably benign 0.33
R1563:Klhl35 UTSW 7 99471695 missense probably damaging 1.00
R1770:Klhl35 UTSW 7 99473875 missense possibly damaging 0.57
R1901:Klhl35 UTSW 7 99470220 missense probably damaging 1.00
R2392:Klhl35 UTSW 7 99473824 missense possibly damaging 0.72
R4194:Klhl35 UTSW 7 99473851 unclassified probably null
R4349:Klhl35 UTSW 7 99473719 missense probably benign 0.18
R4960:Klhl35 UTSW 7 99469068 missense probably damaging 1.00
R5846:Klhl35 UTSW 7 99472887 missense probably damaging 0.97
R6161:Klhl35 UTSW 7 99473337 unclassified probably benign
R6494:Klhl35 UTSW 7 99472899 missense probably damaging 1.00
R7060:Klhl35 UTSW 7 99468458 missense possibly damaging 0.81
R7758:Klhl35 UTSW 7 99473218 missense unknown
R7762:Klhl35 UTSW 7 99468440 missense probably benign 0.11
R8022:Klhl35 UTSW 7 99473239 missense unknown
X0023:Klhl35 UTSW 7 99470341 nonsense probably null
X0064:Klhl35 UTSW 7 99471841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTTCAGTAATCCCCAGC -3'
(R):5'- TGCTGGACCACACAGTTTTAG -3'

Sequencing Primer
(F):5'- AGTAATCCCCAGCACCGTTTGG -3'
(R):5'- TGGACCACACAGTTTTAGTCACTAAC -3'
Posted On2015-04-02