Incidental Mutation 'R3810:Orc6'
ID275163
Institutional Source Beutler Lab
Gene Symbol Orc6
Ensembl Gene ENSMUSG00000031697
Gene Nameorigin recognition complex, subunit 6
Synonyms6720420I10Rik, Orc6l
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85299632-85308278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85299984 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 19 (S19R)
Ref Sequence ENSEMBL: ENSMUSP00000147488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034131] [ENSMUST00000034132] [ENSMUST00000170141] [ENSMUST00000210146] [ENSMUST00000211396] [ENSMUST00000211597]
Predicted Effect probably benign
Transcript: ENSMUST00000034131
SMART Domains Protein: ENSMUSP00000034131
Gene: ENSMUSG00000031696

DomainStartEndE-ValueType
Pfam:Vps35 15 753 6.8e-303 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034132
AA Change: S19R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000034132
Gene: ENSMUSG00000031697
AA Change: S19R

DomainStartEndE-ValueType
Pfam:ORC6 6 108 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170141
SMART Domains Protein: ENSMUSP00000126925
Gene: ENSMUSG00000031697

DomainStartEndE-ValueType
PDB:3M03|C 18 111 2e-51 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209733
Predicted Effect probably benign
Transcript: ENSMUST00000210146
AA Change: S19R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211154
Predicted Effect probably benign
Transcript: ENSMUST00000211396
AA Change: S19R

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211479
Predicted Effect probably benign
Transcript: ENSMUST00000211597
AA Change: S19R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Gene silencing studies with small interfering RNA demonstrated that this protein plays an essential role in coordinating chromosome replication and segregation with cytokinesis. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Orc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Orc6 APN 8 85307643 missense probably damaging 1.00
IGL02531:Orc6 APN 8 85303369 missense probably damaging 1.00
IGL02713:Orc6 APN 8 85307586 missense probably benign 0.00
IGL02997:Orc6 APN 8 85306208 unclassified probably benign
R0685:Orc6 UTSW 8 85301154 missense possibly damaging 0.93
R1667:Orc6 UTSW 8 85305285 missense possibly damaging 0.94
R3619:Orc6 UTSW 8 85299994 critical splice donor site probably null
R4707:Orc6 UTSW 8 85302950 missense probably damaging 1.00
R4784:Orc6 UTSW 8 85302950 missense probably damaging 1.00
R5743:Orc6 UTSW 8 85302956 missense probably benign 0.02
R7062:Orc6 UTSW 8 85302908 missense probably damaging 1.00
R7199:Orc6 UTSW 8 85302961 critical splice donor site probably null
R7803:Orc6 UTSW 8 85303408 missense possibly damaging 0.77
R7880:Orc6 UTSW 8 85305244 missense probably benign 0.01
R7963:Orc6 UTSW 8 85305244 missense probably benign 0.01
Y5406:Orc6 UTSW 8 85307673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGGAACGGTCTCAACC -3'
(R):5'- TTTCCGACCACAGTGTATCCAAC -3'

Sequencing Primer
(F):5'- GAACGGTCTCAACCTCTGGTC -3'
(R):5'- GTATCCAACAGAGCTAGAGTGCTTC -3'
Posted On2015-04-02