Incidental Mutation 'R3810:Dock6'
ID275164
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21801577 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1995 (K1995E)
Ref Sequence ENSEMBL: ENSMUSP00000034728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034717] [ENSMUST00000034728] [ENSMUST00000213691] [ENSMUST00000216008] [ENSMUST00000217336]
Predicted Effect probably benign
Transcript: ENSMUST00000034717
SMART Domains Protein: ENSMUSP00000034717
Gene: ENSMUSG00000032194

DomainStartEndE-ValueType
Pfam:KN_motif 31 69 9.6e-26 PFAM
low complexity region 139 157 N/A INTRINSIC
coiled coil region 213 229 N/A INTRINSIC
coiled coil region 284 316 N/A INTRINSIC
low complexity region 324 343 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
ANK 658 688 6.36e-3 SMART
ANK 692 725 7.29e2 SMART
ANK 730 759 4.97e-5 SMART
ANK 763 793 3.85e-2 SMART
ANK 797 825 1.06e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000034728
AA Change: K1995E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: K1995E

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213691
Predicted Effect probably benign
Transcript: ENSMUST00000215729
Predicted Effect probably benign
Transcript: ENSMUST00000216008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217310
Predicted Effect probably benign
Transcript: ENSMUST00000217336
AA Change: K2026E

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
backwater UTSW 9 21824416 missense probably benign 0.29
bayfront UTSW 9 21821745 missense probably benign 0.29
marshland UTSW 9 21841603 missense probably benign 0.00
Shallows UTSW 9 21820622 missense probably benign
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 splice site probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21801207 missense unknown
R7863:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R7991:Dock6 UTSW 9 21846562 missense probably damaging 1.00
R7992:Dock6 UTSW 9 21832839 critical splice donor site probably null
R8012:Dock6 UTSW 9 21846511 missense probably benign 0.16
R8184:Dock6 UTSW 9 21830300 missense possibly damaging 0.54
R8213:Dock6 UTSW 9 21831444 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAGAGGGATGTGCATGTGTC -3'
(R):5'- TCCAGATGCCAAGATGCTGC -3'

Sequencing Primer
(F):5'- TCTGGGGTGATCATACACAGGC -3'
(R):5'- CCAAGATGCTGCAGATGGTTCTC -3'
Posted On2015-04-02