Incidental Mutation 'R3810:Entpd3'
ID275166
Institutional Source Beutler Lab
Gene Symbol Entpd3
Ensembl Gene ENSMUSG00000041608
Gene Nameectonucleoside triphosphate diphosphohydrolase 3
SynonymsHB6, Cd39l3, NTPDase-3
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120539818-120568327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120562002 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 440 (E440G)
Ref Sequence ENSEMBL: ENSMUSP00000036830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047687]
Predicted Effect probably benign
Transcript: ENSMUST00000047687
AA Change: E440G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000036830
Gene: ENSMUSG00000041608
AA Change: E440G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:GDA1_CD39 49 483 4.3e-102 PFAM
transmembrane domain 486 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143579
Meta Mutation Damage Score 0.0808 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a plasma membrane-bound divalent cation-dependent E-type nucleotidase. The encoded protein is involved in the regulation of extracellular levels of ATP by hydrolysis of it and other nucleotides. Multiple transcript variants have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no deficits in nucleotide hydrolysis or alterations in nociceptive behaviors except for a modest reduction in beta-alanine-mediated itch behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Entpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Entpd3 APN 9 120561941 missense probably damaging 1.00
R0054:Entpd3 UTSW 9 120557542 missense probably damaging 0.99
R0265:Entpd3 UTSW 9 120558481 missense probably damaging 1.00
R0417:Entpd3 UTSW 9 120557421 missense probably damaging 0.99
R0607:Entpd3 UTSW 9 120557405 missense possibly damaging 0.63
R1028:Entpd3 UTSW 9 120558361 missense probably benign 0.06
R1449:Entpd3 UTSW 9 120566489 missense probably damaging 1.00
R1490:Entpd3 UTSW 9 120554159 missense probably benign 0.03
R1846:Entpd3 UTSW 9 120558375 missense probably benign 0.33
R1848:Entpd3 UTSW 9 120558419 missense probably damaging 1.00
R2125:Entpd3 UTSW 9 120555654 missense probably damaging 1.00
R5101:Entpd3 UTSW 9 120566542 makesense probably null
R5109:Entpd3 UTSW 9 120566314 missense possibly damaging 0.95
R6822:Entpd3 UTSW 9 120562038 critical splice donor site probably null
R6968:Entpd3 UTSW 9 120560656 missense probably benign 0.01
R7107:Entpd3 UTSW 9 120560599 missense probably damaging 1.00
R7132:Entpd3 UTSW 9 120561020 missense probably benign 0.00
R7310:Entpd3 UTSW 9 120560755 critical splice donor site probably null
R7776:Entpd3 UTSW 9 120558502 missense probably damaging 1.00
R7831:Entpd3 UTSW 9 120543959 missense probably damaging 1.00
R7871:Entpd3 UTSW 9 120560586 missense possibly damaging 0.81
R7914:Entpd3 UTSW 9 120543959 missense probably damaging 1.00
R7954:Entpd3 UTSW 9 120560586 missense possibly damaging 0.81
X0017:Entpd3 UTSW 9 120555749 missense probably benign 0.41
X0024:Entpd3 UTSW 9 120561900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGTCTCAGCTCTTGTGC -3'
(R):5'- GGAGCAACTTGAAATCTTGTCAC -3'

Sequencing Primer
(F):5'- TCATGGGTGACAGGTTTTGAAACAC -3'
(R):5'- GAAATCTTGTCACCTCTTTTCCTGAG -3'
Posted On2015-04-02