Incidental Mutation 'R3810:Metap2'
ID275168
Institutional Source Beutler Lab
Gene Symbol Metap2
Ensembl Gene ENSMUSG00000036112
Gene Namemethionine aminopeptidase 2
Synonymsp67, 4930584B20Rik, A930035J23Rik, eIF-2-associated p67
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93858489-93897093 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 93870164 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 252 (L252*)
Ref Sequence ENSEMBL: ENSMUSP00000138083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047910] [ENSMUST00000180688] [ENSMUST00000180840] [ENSMUST00000181091] [ENSMUST00000181217] [ENSMUST00000181470]
Predicted Effect probably null
Transcript: ENSMUST00000047910
AA Change: L242*
SMART Domains Protein: ENSMUSP00000048285
Gene: ENSMUSG00000036112
AA Change: L242*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 167 466 1.2e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180375
AA Change: L215*
Predicted Effect probably null
Transcript: ENSMUST00000180392
AA Change: L99*
Predicted Effect probably benign
Transcript: ENSMUST00000180688
SMART Domains Protein: ENSMUSP00000137652
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 76 107 N/A INTRINSIC
Pfam:Peptidase_M24 166 233 2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180840
AA Change: L242*
SMART Domains Protein: ENSMUSP00000138006
Gene: ENSMUSG00000036112
AA Change: L242*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 167 466 2.8e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000181091
AA Change: L219*
SMART Domains Protein: ENSMUSP00000137904
Gene: ENSMUSG00000036112
AA Change: L219*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 144 443 2.2e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000181217
AA Change: L252*
SMART Domains Protein: ENSMUSP00000138083
Gene: ENSMUSG00000036112
AA Change: L252*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 177 476 2.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181442
Predicted Effect probably benign
Transcript: ENSMUST00000181470
SMART Domains Protein: ENSMUSP00000138050
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
Pfam:Peptidase_M24 1 97 6.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216232
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the methionyl aminopeptidase family. The encoded protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent proteins. Increased expression of this gene is associated with various forms of cancer, and the anti-cancer drugs fumagillin and ovalicin inhibit the protein by irreversibly binding to its active site. Inhibitors of this gene have also been shown to be effective for the treatment of obesity. A pseudogene of this gene is located on chromosome 2. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E8.5, smaller size, failure to gastrulate, reduced cell proliferation and absence of a distinct mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Metap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Metap2 APN 10 93871478 splice site probably benign
IGL02553:Metap2 APN 10 93865449 missense probably damaging 1.00
R0212:Metap2 UTSW 10 93861380 missense probably damaging 1.00
R0749:Metap2 UTSW 10 93879567 missense probably benign 0.43
R1183:Metap2 UTSW 10 93870184 missense probably damaging 1.00
R1459:Metap2 UTSW 10 93868949 missense probably damaging 1.00
R1468:Metap2 UTSW 10 93871483 splice site probably null
R1468:Metap2 UTSW 10 93871483 splice site probably null
R1646:Metap2 UTSW 10 93870197 missense probably damaging 1.00
R3811:Metap2 UTSW 10 93870164 nonsense probably null
R3812:Metap2 UTSW 10 93870164 nonsense probably null
R4174:Metap2 UTSW 10 93879565 missense possibly damaging 0.68
R4801:Metap2 UTSW 10 93868895 missense probably damaging 1.00
R4802:Metap2 UTSW 10 93868895 missense probably damaging 1.00
R4983:Metap2 UTSW 10 93889600 missense possibly damaging 0.86
R5030:Metap2 UTSW 10 93879677 splice site probably null
R5276:Metap2 UTSW 10 93868922 missense possibly damaging 0.93
R5276:Metap2 UTSW 10 93868932 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTACAGCTTTAGAGAAGGAGCC -3'
(R):5'- ATGAGCTCCGCATTCAGAAAG -3'

Sequencing Primer
(F):5'- CAGCTTTAGAGAAGGAGCCAAGAAC -3'
(R):5'- TGAGCTCCGCATTCAGAAAGTACTC -3'
Posted On2015-04-02