Incidental Mutation 'R3810:Neurl4'
ID275169
Institutional Source Beutler Lab
Gene Symbol Neurl4
Ensembl Gene ENSMUSG00000047284
Gene Nameneuralized E3 ubiquitin protein ligase 4
Synonyms0610025P10Rik
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69901072-69913820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69904033 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 323 (H323R)
Ref Sequence ENSEMBL: ENSMUSP00000135185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018714] [ENSMUST00000061837] [ENSMUST00000100969] [ENSMUST00000102580] [ENSMUST00000108617] [ENSMUST00000108621] [ENSMUST00000128046] [ENSMUST00000129234] [ENSMUST00000129475] [ENSMUST00000133203] [ENSMUST00000144431] [ENSMUST00000177138] [ENSMUST00000177476]
Predicted Effect probably benign
Transcript: ENSMUST00000018714
SMART Domains Protein: ENSMUSP00000018714
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061837
AA Change: H323R

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284
AA Change: H323R

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100969
SMART Domains Protein: ENSMUSP00000098529
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 272 5.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102580
SMART Domains Protein: ENSMUSP00000099640
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 153 270 6.2e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108617
AA Change: H301R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284
AA Change: H301R

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108621
SMART Domains Protein: ENSMUSP00000104261
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128046
SMART Domains Protein: ENSMUSP00000137547
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
Pfam:IPP-2 1 77 1.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129234
SMART Domains Protein: ENSMUSP00000136835
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129475
SMART Domains Protein: ENSMUSP00000135733
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 1 119 4.22e-44 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
internal_repeat_1 206 246 1.46e-10 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000133203
AA Change: H66R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284
AA Change: H66R

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143861
Predicted Effect probably benign
Transcript: ENSMUST00000144431
SMART Domains Protein: ENSMUSP00000135926
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176614
Predicted Effect probably damaging
Transcript: ENSMUST00000177138
AA Change: H301R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284
AA Change: H301R

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177160
Predicted Effect probably damaging
Transcript: ENSMUST00000177476
AA Change: H323R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284
AA Change: H323R

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Meta Mutation Damage Score 0.7851 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted and it includes two isoforms resulting from two alternatively spliced transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Neurl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Neurl4 APN 11 69904587 missense probably damaging 1.00
IGL00516:Neurl4 APN 11 69910393 missense probably damaging 0.98
IGL01409:Neurl4 APN 11 69907099 missense probably damaging 1.00
IGL01951:Neurl4 APN 11 69909623 missense probably damaging 1.00
IGL02056:Neurl4 APN 11 69905790 missense probably damaging 1.00
IGL02206:Neurl4 APN 11 69910340 missense probably damaging 1.00
IGL02557:Neurl4 APN 11 69906335 missense probably damaging 1.00
IGL02878:Neurl4 APN 11 69906831 missense probably damaging 1.00
P0022:Neurl4 UTSW 11 69909065 missense possibly damaging 0.86
PIT4377001:Neurl4 UTSW 11 69910406 missense probably benign 0.41
R0388:Neurl4 UTSW 11 69911733 splice site probably benign
R0421:Neurl4 UTSW 11 69908534 missense probably damaging 1.00
R0449:Neurl4 UTSW 11 69905567 missense probably damaging 0.99
R1174:Neurl4 UTSW 11 69903721 critical splice donor site probably null
R1345:Neurl4 UTSW 11 69903876 missense probably benign 0.21
R1536:Neurl4 UTSW 11 69903426 nonsense probably null
R1642:Neurl4 UTSW 11 69903659 missense probably benign 0.03
R1857:Neurl4 UTSW 11 69905535 missense probably damaging 1.00
R1935:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1936:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1967:Neurl4 UTSW 11 69903210 missense possibly damaging 0.90
R1973:Neurl4 UTSW 11 69909292 missense probably benign
R2046:Neurl4 UTSW 11 69908697 missense probably damaging 1.00
R2165:Neurl4 UTSW 11 69903221 missense probably benign
R2393:Neurl4 UTSW 11 69907074 missense probably damaging 1.00
R4299:Neurl4 UTSW 11 69909061 missense probably damaging 1.00
R4749:Neurl4 UTSW 11 69911068 missense probably benign 0.00
R4898:Neurl4 UTSW 11 69903171 missense probably damaging 0.99
R4968:Neurl4 UTSW 11 69907308 missense probably damaging 1.00
R4969:Neurl4 UTSW 11 69911087 missense probably damaging 1.00
R5503:Neurl4 UTSW 11 69906368 missense probably damaging 1.00
R6655:Neurl4 UTSW 11 69910916 critical splice donor site probably null
R6791:Neurl4 UTSW 11 69908510 missense probably damaging 1.00
R7029:Neurl4 UTSW 11 69910736 missense probably damaging 0.99
R7216:Neurl4 UTSW 11 69910262 missense probably damaging 1.00
R7361:Neurl4 UTSW 11 69912079 missense probably benign 0.01
R7367:Neurl4 UTSW 11 69908582 missense probably damaging 1.00
R7804:Neurl4 UTSW 11 69905874 missense probably benign 0.00
R7871:Neurl4 UTSW 11 69903186 missense probably benign
R7954:Neurl4 UTSW 11 69903186 missense probably benign
X0025:Neurl4 UTSW 11 69906801 missense probably damaging 1.00
Z1177:Neurl4 UTSW 11 69904090 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GAGAGCTCTGTCTTGACTTCC -3'
(R):5'- TATTGCCGCCAAAGATCAATCC -3'

Sequencing Primer
(F):5'- CTTGCTGCTACAGACTTTGCCAG -3'
(R):5'- AAGATCAATCCCTACGTTTAGCTC -3'
Posted On2015-04-02