Incidental Mutation 'R3810:Gm9637'
ID275175
Institutional Source Beutler Lab
Gene Symbol Gm9637
Ensembl Gene ENSMUSG00000093814
Gene Namepredicted gene 9637
Synonyms
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location19401727-19402599 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 19402398 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179141
SMART Domains Protein: ENSMUSP00000137522
Gene: ENSMUSG00000093814

DomainStartEndE-ValueType
S_TKc 36 283 1.12e-85 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Gm9637
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Gm9637 APN 14 19402545 exon noncoding transcript
IGL02449:Gm9637 APN 14 19402436 exon noncoding transcript
IGL02492:Gm9637 APN 14 19402182 exon noncoding transcript
IGL03060:Gm9637 APN 14 19402173 exon noncoding transcript
R0062:Gm9637 UTSW 14 19402570 exon noncoding transcript
R0621:Gm9637 UTSW 14 19402011 exon noncoding transcript
R1122:Gm9637 UTSW 14 19401879 exon noncoding transcript
R1762:Gm9637 UTSW 14 19402408 exon noncoding transcript
R1812:Gm9637 UTSW 14 19402395 exon noncoding transcript
R2880:Gm9637 UTSW 14 19401978 exon noncoding transcript
R3685:Gm9637 UTSW 14 19401950 exon noncoding transcript
R3812:Gm9637 UTSW 14 19402398 exon noncoding transcript
R5415:Gm9637 UTSW 14 19402143 exon noncoding transcript
Z1088:Gm9637 UTSW 14 19401731 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACTGGAGGGCATACACCATC -3'
(R):5'- ACCTATCAGCAATGAGGTGGC -3'

Sequencing Primer
(F):5'- GTTTAAACAGCCTGTGGAACTCC -3'
(R):5'- CAAGCATGTCAGGACCTCAGG -3'
Posted On2015-04-02