Incidental Mutation 'R3810:Pcdh12'
ID275178
Institutional Source Beutler Lab
Gene Symbol Pcdh12
Ensembl Gene ENSMUSG00000024440
Gene Nameprotocadherin 12
SynonymsVE-cadherin-2, vascular endothelial cadherin-2
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3810 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38267092-38284402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38281237 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 945 (E945G)
Ref Sequence ENSEMBL: ENSMUSP00000025311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]
Predicted Effect probably damaging
Transcript: ENSMUST00000025311
AA Change: E945G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: E945G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 53 133 4.42e-2 SMART
CA 157 242 2.55e-17 SMART
CA 266 350 2.31e-24 SMART
CA 376 458 3.86e-26 SMART
CA 482 563 6.27e-26 SMART
CA 621 704 3.02e-2 SMART
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 960 975 N/A INTRINSIC
low complexity region 1032 1041 N/A INTRINSIC
low complexity region 1115 1125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193123
Predicted Effect probably benign
Transcript: ENSMUST00000194012
SMART Domains Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195747
Meta Mutation Damage Score 0.1987 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm20939 G A 17: 94,876,710 R262K possibly damaging Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Pcdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcdh12 APN 18 38281457 missense probably benign
IGL00964:Pcdh12 APN 18 38282731 missense probably benign 0.27
IGL01105:Pcdh12 APN 18 38275347 missense probably damaging 1.00
IGL02011:Pcdh12 APN 18 38281420 missense probably damaging 1.00
IGL02234:Pcdh12 APN 18 38283535 missense probably damaging 1.00
IGL02452:Pcdh12 APN 18 38281693 missense probably benign 0.00
IGL03412:Pcdh12 APN 18 38283515 missense probably benign 0.24
R0729:Pcdh12 UTSW 18 38282464 missense probably benign 0.20
R1330:Pcdh12 UTSW 18 38281861 missense probably benign 0.13
R1394:Pcdh12 UTSW 18 38281189 critical splice donor site probably null
R1413:Pcdh12 UTSW 18 38283443 missense probably damaging 1.00
R1993:Pcdh12 UTSW 18 38282143 missense possibly damaging 0.62
R2115:Pcdh12 UTSW 18 38283986 missense probably damaging 1.00
R2567:Pcdh12 UTSW 18 38282096 missense probably damaging 1.00
R2926:Pcdh12 UTSW 18 38282390 missense probably damaging 0.99
R3813:Pcdh12 UTSW 18 38283614 nonsense probably null
R5275:Pcdh12 UTSW 18 38284101 utr 5 prime probably benign
R5400:Pcdh12 UTSW 18 38268898 missense probably damaging 1.00
R5523:Pcdh12 UTSW 18 38283139 missense probably damaging 1.00
R5539:Pcdh12 UTSW 18 38281744 missense possibly damaging 0.77
R5604:Pcdh12 UTSW 18 38268882 missense probably damaging 1.00
R6012:Pcdh12 UTSW 18 38283752 missense probably damaging 1.00
R6042:Pcdh12 UTSW 18 38281505 missense probably damaging 1.00
R6129:Pcdh12 UTSW 18 38277859 missense probably damaging 1.00
R6239:Pcdh12 UTSW 18 38282401 missense probably damaging 1.00
R6508:Pcdh12 UTSW 18 38281337 nonsense probably null
R7250:Pcdh12 UTSW 18 38281976 missense probably benign
R7259:Pcdh12 UTSW 18 38281624 missense probably benign 0.00
R7271:Pcdh12 UTSW 18 38283047 missense probably damaging 1.00
R7489:Pcdh12 UTSW 18 38281789 missense possibly damaging 0.77
Z1177:Pcdh12 UTSW 18 38282992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGCATCACCCAGTACTGAG -3'
(R):5'- GAGAACCTAAACCTTCCTGAGTCC -3'

Sequencing Primer
(F):5'- TCACCCAGTACTGAGTGAGTCTAAG -3'
(R):5'- CACTCTTAAGGCCTCTGAAGGTG -3'
Posted On2015-04-02