Incidental Mutation 'R3811:Psmd1'
ID275179
Institutional Source Beutler Lab
Gene Symbol Psmd1
Ensembl Gene ENSMUSG00000026229
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 1
SynonymsS1, P112
MMRRC Submission 040767-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R3811 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location86064387-86139151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86132715 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 828 (V828D)
Ref Sequence ENSEMBL: ENSMUSP00000027432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027432] [ENSMUST00000139715]
Predicted Effect probably damaging
Transcript: ENSMUST00000027432
AA Change: V828D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027432
Gene: ENSMUSG00000026229
AA Change: V828D

DomainStartEndE-ValueType
Pfam:PC_rep 441 474 5.1e-9 PFAM
Pfam:PC_rep 476 510 8.4e-8 PFAM
Pfam:PC_rep 511 545 1.1e-7 PFAM
Pfam:HEAT_2 599 693 3.3e-15 PFAM
Pfam:PC_rep 651 685 1.1e-11 PFAM
low complexity region 818 828 N/A INTRINSIC
low complexity region 837 872 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135197
Predicted Effect probably benign
Transcript: ENSMUST00000139715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152184
Meta Mutation Damage Score 0.5319 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: In eukaryotic cells, most proteins in the cytosol and nucleus are degraded via the ubiquitin-proteasome pathway. The 26S proteasome is a self-compartmentalizing protease comprised of approximately 31 different subunits. It contains a barrel-shaped proteolytic core complex (the 20S proteasome), capped at one or both ends by 19S regulatory complexes, which recognize ubiquitinated proteins. Protein degradation by proteasomes is the source of most antigenic peptides presented on MHC class I molecules. This gene encodes a non-ATPase subunit of the 26S proteasome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Psmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Psmd1 APN 1 86090198 splice site probably benign
IGL02410:Psmd1 APN 1 86077437 missense probably damaging 0.97
IGL02455:Psmd1 APN 1 86078580 missense probably damaging 0.97
IGL03015:Psmd1 APN 1 86128192 missense probably damaging 0.97
IGL03100:Psmd1 APN 1 86118521 missense possibly damaging 0.68
Rickety UTSW 1 86070628 critical splice donor site probably null
PIT4480001:Psmd1 UTSW 1 86128238 missense probably damaging 0.99
R0027:Psmd1 UTSW 1 86094265 splice site probably benign
R0115:Psmd1 UTSW 1 86083271 missense possibly damaging 0.89
R0201:Psmd1 UTSW 1 86118616 missense probably benign 0.11
R0206:Psmd1 UTSW 1 86133741 missense possibly damaging 0.94
R0208:Psmd1 UTSW 1 86133741 missense possibly damaging 0.94
R0255:Psmd1 UTSW 1 86078582 missense probably damaging 1.00
R0486:Psmd1 UTSW 1 86094290 missense probably damaging 0.99
R0675:Psmd1 UTSW 1 86082039 missense probably benign 0.03
R0790:Psmd1 UTSW 1 86077450 missense possibly damaging 0.94
R1565:Psmd1 UTSW 1 86091997 splice site probably benign
R1721:Psmd1 UTSW 1 86071845 missense probably damaging 0.99
R2010:Psmd1 UTSW 1 86075997 missense probably damaging 0.96
R2098:Psmd1 UTSW 1 86082101 splice site probably null
R2118:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2119:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2120:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2122:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2504:Psmd1 UTSW 1 86089997 missense possibly damaging 0.91
R3810:Psmd1 UTSW 1 86132715 missense probably damaging 0.99
R3978:Psmd1 UTSW 1 86128187 missense probably benign 0.05
R4131:Psmd1 UTSW 1 86078700 missense probably damaging 0.98
R4360:Psmd1 UTSW 1 86133737 missense probably damaging 0.97
R4386:Psmd1 UTSW 1 86128192 missense possibly damaging 0.93
R4402:Psmd1 UTSW 1 86075951 missense possibly damaging 0.59
R4591:Psmd1 UTSW 1 86128204 missense probably benign 0.05
R4783:Psmd1 UTSW 1 86078712 missense probably damaging 0.97
R4824:Psmd1 UTSW 1 86137098 missense probably benign 0.08
R4937:Psmd1 UTSW 1 86083225 missense probably damaging 0.98
R5443:Psmd1 UTSW 1 86090183 missense probably damaging 0.99
R5486:Psmd1 UTSW 1 86137050 missense possibly damaging 0.59
R5979:Psmd1 UTSW 1 86090053 missense possibly damaging 0.92
R6033:Psmd1 UTSW 1 86137095 missense probably damaging 1.00
R6425:Psmd1 UTSW 1 86070628 critical splice donor site probably null
R7467:Psmd1 UTSW 1 86116633 missense probably damaging 0.99
R8257:Psmd1 UTSW 1 86078623 missense probably damaging 0.99
Z1177:Psmd1 UTSW 1 86083168 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCAGGGCAGATCTAAAAGATTGG -3'
(R):5'- CTCATTGAAAAGGCTGAGAGC -3'

Sequencing Primer
(F):5'- TTTGGAGACAGCCTCAGTAGC -3'
(R):5'- CAAAGTACAACAGTGTTTAAGGAATC -3'
Posted On2015-04-02