Incidental Mutation 'R3811:Rbbp5'
ID275180
Institutional Source Beutler Lab
Gene Symbol Rbbp5
Ensembl Gene ENSMUSG00000026439
Gene Nameretinoblastoma binding protein 5, histone lysine methyltransferase complex subunit
Synonyms4933411J24Rik
MMRRC Submission 040767-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R3811 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132477365-132505659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132492587 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000027700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027700] [ENSMUST00000187505] [ENSMUST00000188575] [ENSMUST00000189786] [ENSMUST00000190825] [ENSMUST00000190997]
PDB Structure
WDR5 IN COMPLEX WITH AN RBBP5 PEPTIDE RECRUITED TO NOVEL SITE [X-RAY DIFFRACTION]
WDR5 IN COMPLEX WITH AN RBBP5 PEPTIDE AND HISTONE H3 PEPTIDE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027700
AA Change: V59A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027700
Gene: ENSMUSG00000026439
AA Change: V59A

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187505
AA Change: V59A

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141176
Gene: ENSMUSG00000026439
AA Change: V59A

DomainStartEndE-ValueType
Blast:WD40 1 52 9e-13 BLAST
WD40 55 99 5.1e-3 SMART
WD40 114 153 7.9e-2 SMART
WD40 156 195 1.9e-2 SMART
low complexity region 217 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188575
SMART Domains Protein: ENSMUSP00000140344
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
Blast:WD40 14 55 9e-9 BLAST
SCOP:d1gxra_ 34 87 8e-8 SMART
Blast:WD40 58 107 8e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189786
SMART Domains Protein: ENSMUSP00000140790
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 1 27 1.2e0 SMART
WD40 30 69 4.6e-9 SMART
Blast:WD40 72 149 2e-32 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000190825
AA Change: V186A

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139519
Gene: ENSMUSG00000026439
AA Change: V186A

DomainStartEndE-ValueType
WD40 14 52 1.4e-3 SMART
WD40 55 94 4.6e-9 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 5.1e-3 SMART
WD40 241 280 7.9e-2 SMART
WD40 283 322 1.9e-2 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190997
AA Change: V186A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141003
Gene: ENSMUSG00000026439
AA Change: V186A

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Meta Mutation Damage Score 0.1089 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed nuclear protein which belongs to a highly conserved subfamily of WD-repeat proteins. The encoded protein binds directly to retinoblastoma protein, which regulates cell proliferation. It interacts preferentially with the underphosphorylated retinoblastoma protein via the E1A-binding pocket B. Three alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Psmd9 C T 5: 123,234,590 probably benign Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Rbbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Rbbp5 APN 1 132489706 missense probably damaging 1.00
IGL01373:Rbbp5 APN 1 132492601 missense probably benign 0.07
IGL01577:Rbbp5 APN 1 132492655 missense possibly damaging 0.68
IGL01728:Rbbp5 APN 1 132498080 missense probably benign
R0097:Rbbp5 UTSW 1 132490489 missense possibly damaging 0.81
R0420:Rbbp5 UTSW 1 132493844 missense possibly damaging 0.88
R1540:Rbbp5 UTSW 1 132494282 nonsense probably null
R1965:Rbbp5 UTSW 1 132494297 missense probably damaging 1.00
R2419:Rbbp5 UTSW 1 132493826 missense possibly damaging 0.95
R2924:Rbbp5 UTSW 1 132492663 critical splice donor site probably null
R3810:Rbbp5 UTSW 1 132492587 missense probably damaging 0.98
R4234:Rbbp5 UTSW 1 132484758 missense probably benign 0.08
R5024:Rbbp5 UTSW 1 132490488 missense possibly damaging 0.65
R5166:Rbbp5 UTSW 1 132490565 missense possibly damaging 0.60
R5435:Rbbp5 UTSW 1 132494275 missense probably damaging 1.00
R6018:Rbbp5 UTSW 1 132494340 missense probably damaging 1.00
R6172:Rbbp5 UTSW 1 132496816 missense possibly damaging 0.89
R7500:Rbbp5 UTSW 1 132494141 missense probably benign 0.35
X0019:Rbbp5 UTSW 1 132489698 missense probably damaging 1.00
X0025:Rbbp5 UTSW 1 132489658 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCTATGTGTCGTCACTAGT -3'
(R):5'- TAAGGCCGCACTGACACCT -3'

Sequencing Primer
(F):5'- ATGTGTCGTCACTAGTTTGTTTCCAC -3'
(R):5'- AGTGCCATTATCTCTGCACTCAGG -3'
Posted On2015-04-02