Incidental Mutation 'R3811:Cacybp'
ID275183
Institutional Source Beutler Lab
Gene Symbol Cacybp
Ensembl Gene ENSMUSG00000014226
Gene Namecalcyclin binding protein
Synonyms
MMRRC Submission 040767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3811 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location160202367-160212875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160203652 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 202 (D202G)
Ref Sequence ENSEMBL: ENSMUSP00000014370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014370] [ENSMUST00000078878] [ENSMUST00000097193] [ENSMUST00000135680] [ENSMUST00000195654]
PDB Structure
NMR Structure of N-terminal domain (Residues 1-77) of Siah-Interacting Protein. [SOLUTION NMR]
Solution structure of calcium loaded S100A6 bound to C-terminal Siah-1 interacting protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000014370
AA Change: D202G

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000014370
Gene: ENSMUSG00000014226
AA Change: D202G

DomainStartEndE-ValueType
Pfam:Siah-Interact_N 3 76 2.1e-30 PFAM
Pfam:CS 77 157 3.7e-19 PFAM
Pfam:SGS 162 222 6.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078878
Predicted Effect probably benign
Transcript: ENSMUST00000097193
SMART Domains Protein: ENSMUSP00000107285
Gene: ENSMUSG00000058267

DomainStartEndE-ValueType
Pfam:Ribosomal_S14 67 121 1.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135680
SMART Domains Protein: ENSMUSP00000120075
Gene: ENSMUSG00000058267

DomainStartEndE-ValueType
Pfam:Ribosomal_S14 74 126 1.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194167
Predicted Effect probably benign
Transcript: ENSMUST00000195654
SMART Domains Protein: ENSMUSP00000142252
Gene: ENSMUSG00000014226

DomainStartEndE-ValueType
Pfam:Siah-Interact_N 1 76 5.6e-24 PFAM
Pfam:CS 74 135 5.4e-9 PFAM
Meta Mutation Damage Score 0.3027 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcyclin binding protein. It may be involved in calcium-dependent ubiquitination and subsequent proteosomal degradation of target proteins. It probably serves as a molecular bridge in ubiquitin E3 complexes and participates in the ubiquitin-mediated degradation of beta-catenin. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced thymus and spleen cellularity, and defects in TCR-rearrangement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Cacybp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Cacybp APN 1 160206636 missense probably damaging 0.98
PIT4403001:Cacybp UTSW 1 160206194 missense probably damaging 1.00
R2936:Cacybp UTSW 1 160208377 critical splice donor site probably null
R5420:Cacybp UTSW 1 160208344 intron probably benign
R6495:Cacybp UTSW 1 160208523 missense probably benign 0.35
R6808:Cacybp UTSW 1 160208599 splice site probably null
R7082:Cacybp UTSW 1 160203659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTATCTTTACTTAAAAGGCGGTG -3'
(R):5'- TGGGTTGTATACTCTAGCATCCC -3'

Sequencing Primer
(F):5'- AAGGCGGTGTAAATATTTATCTGTC -3'
(R):5'- GGTTGTATACTCTAGCATCCCTTCTC -3'
Posted On2015-04-02