Incidental Mutation 'R3811:Olfr1066'
ID275185
Institutional Source Beutler Lab
Gene Symbol Olfr1066
Ensembl Gene ENSMUSG00000075181
Gene Nameolfactory receptor 1066
SynonymsMOR256-52P, GA_x6K02T2Q125-47925557-47924616, MOR188-8
MMRRC Submission 040767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3811 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86455328-86456269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86455347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 308 (V308E)
Ref Sequence ENSEMBL: ENSMUSP00000097470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099885] [ENSMUST00000213789] [ENSMUST00000216162] [ENSMUST00000217586]
Predicted Effect probably benign
Transcript: ENSMUST00000099885
AA Change: V308E

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097470
Gene: ENSMUSG00000075181
AA Change: V308E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 172 1.9e-6 PFAM
Pfam:7tm_1 41 290 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213789
Predicted Effect probably benign
Transcript: ENSMUST00000216162
Predicted Effect probably benign
Transcript: ENSMUST00000217586
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Olfr1066
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Olfr1066 APN 2 86455502 missense possibly damaging 0.92
IGL01668:Olfr1066 APN 2 86455402 missense probably damaging 1.00
IGL02016:Olfr1066 APN 2 86455497 missense probably damaging 0.99
R0396:Olfr1066 UTSW 2 86456019 missense possibly damaging 0.54
R0980:Olfr1066 UTSW 2 86455360 missense probably benign 0.01
R0987:Olfr1066 UTSW 2 86455547 nonsense probably null
R1169:Olfr1066 UTSW 2 86455587 missense possibly damaging 0.85
R2001:Olfr1066 UTSW 2 86455473 missense probably benign 0.45
R2002:Olfr1066 UTSW 2 86455473 missense probably benign 0.45
R2265:Olfr1066 UTSW 2 86456214 missense possibly damaging 0.77
R4579:Olfr1066 UTSW 2 86455515 missense probably damaging 0.99
R4726:Olfr1066 UTSW 2 86456236 missense possibly damaging 0.90
R4768:Olfr1066 UTSW 2 86455650 nonsense probably null
R4871:Olfr1066 UTSW 2 86455809 missense possibly damaging 0.95
R5304:Olfr1066 UTSW 2 86455435 missense probably damaging 1.00
R6037:Olfr1066 UTSW 2 86455789 missense probably benign 0.14
R6037:Olfr1066 UTSW 2 86455789 missense probably benign 0.14
R7080:Olfr1066 UTSW 2 86455491 nonsense probably null
R7223:Olfr1066 UTSW 2 86455867 missense possibly damaging 0.78
R7378:Olfr1066 UTSW 2 86456068 missense probably benign 0.10
R7465:Olfr1066 UTSW 2 86455806 missense probably benign 0.07
R7598:Olfr1066 UTSW 2 86455890 missense probably damaging 0.98
X0025:Olfr1066 UTSW 2 86455869 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGAAATCAGTGCATGGTGTCTG -3'
(R):5'- CAGTTGTCATCGTCTTTTATGGGAC -3'

Sequencing Primer
(F):5'- TACGAATGAGACCTTAACATCTAAGC -3'
(R):5'- ATCGTCTTTTATGGGACTTTGATATG -3'
Posted On2015-04-02