Incidental Mutation 'R3811:Galntl5'
ID275193
Institutional Source Beutler Lab
Gene Symbol Galntl5
Ensembl Gene ENSMUSG00000028938
Gene NameUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Synonyms1700021B12Rik
MMRRC Submission 040767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3811 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location25181460-25220297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25186180 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 26 (F26L)
Ref Sequence ENSEMBL: ENSMUSP00000030778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030778] [ENSMUST00000114965]
Predicted Effect probably benign
Transcript: ENSMUST00000030778
AA Change: F26L

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030778
Gene: ENSMUSG00000028938
AA Change: F26L

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 365 4.1e-10 PFAM
Pfam:Glycos_transf_2 118 304 4.2e-30 PFAM
Pfam:Glyco_tranf_2_2 118 383 1.7e-7 PFAM
Pfam:Glyco_transf_7C 277 349 2.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114965
SMART Domains Protein: ENSMUSP00000110616
Gene: ENSMUSG00000028938

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 82 332 1.8e-10 PFAM
Pfam:Glycos_transf_2 85 271 3.3e-28 PFAM
Pfam:Glyco_tranf_2_2 85 350 8.1e-8 PFAM
Pfam:Glyco_transf_7C 244 316 2.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158217
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Male heterozygous mice for this allele were infertile due to decreased sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Galntl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Galntl5 APN 5 25195351 missense probably damaging 1.00
IGL01637:Galntl5 APN 5 25189825 splice site probably benign
IGL02126:Galntl5 APN 5 25189841 missense possibly damaging 0.75
IGL02136:Galntl5 APN 5 25220062 missense probably benign 0.16
IGL02836:Galntl5 APN 5 25186239 missense probably benign
R0076:Galntl5 UTSW 5 25186072 critical splice acceptor site probably null
R0411:Galntl5 UTSW 5 25220174 missense probably benign 0.20
R1376:Galntl5 UTSW 5 25186288 missense probably benign 0.16
R1376:Galntl5 UTSW 5 25186288 missense probably benign 0.16
R1686:Galntl5 UTSW 5 25210434 missense probably benign 0.16
R1724:Galntl5 UTSW 5 25220122 missense possibly damaging 0.94
R1899:Galntl5 UTSW 5 25198532 nonsense probably null
R2213:Galntl5 UTSW 5 25217529 missense probably benign 0.13
R2215:Galntl5 UTSW 5 25198478 missense probably damaging 1.00
R2425:Galntl5 UTSW 5 25220081 missense probably damaging 0.99
R3812:Galntl5 UTSW 5 25186180 missense probably benign 0.19
R4072:Galntl5 UTSW 5 25198480 nonsense probably null
R4660:Galntl5 UTSW 5 25203379 missense probably damaging 1.00
R5792:Galntl5 UTSW 5 25198463 missense possibly damaging 0.59
R5844:Galntl5 UTSW 5 25186093 intron probably benign
R6267:Galntl5 UTSW 5 25186165 missense probably benign
R6296:Galntl5 UTSW 5 25186165 missense probably benign
R6896:Galntl5 UTSW 5 25189949 critical splice donor site probably null
R7138:Galntl5 UTSW 5 25189844 missense probably benign 0.13
R7256:Galntl5 UTSW 5 25195300 missense probably benign 0.00
Z1176:Galntl5 UTSW 5 25203189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAACCTAGCTGGATGTTGATC -3'
(R):5'- CAGAAACATCACAATTTGTCCCTGG -3'

Sequencing Primer
(F):5'- GATGTTGATCCTATACATGTGTGAAG -3'
(R):5'- CCCTGGATATAATTCAGATTTCCCAG -3'
Posted On2015-04-02