Incidental Mutation 'R3811:Psmd9'
ID275194
Institutional Source Beutler Lab
Gene Symbol Psmd9
Ensembl Gene ENSMUSG00000029440
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Synonyms1500011J20Rik, P27, Bridge-1
MMRRC Submission 040767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R3811 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123169413-123250131 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 123234590 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100729] [ENSMUST00000197809]
Predicted Effect probably benign
Transcript: ENSMUST00000100729
SMART Domains Protein: ENSMUSP00000098295
Gene: ENSMUSG00000029440

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Blast:PDZ 20 58 7e-7 BLAST
PDB:3WHL|H 23 99 2e-12 PDB
PDZ 121 195 5.02e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181022
Predicted Effect probably benign
Transcript: ENSMUST00000197809
SMART Domains Protein: ENSMUSP00000143635
Gene: ENSMUSG00000029440

DomainStartEndE-ValueType
PDB:3WHL|H 1 53 9e-8 PDB
PDZ 75 148 1.5e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200560
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Psmd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Psmd9 APN 5 123234634 missense probably damaging 0.99
IGL02354:Psmd9 APN 5 123248316 missense probably damaging 1.00
IGL02361:Psmd9 APN 5 123248316 missense probably damaging 1.00
IGL02947:Psmd9 APN 5 123246215 missense probably benign 0.01
R0318:Psmd9 UTSW 5 123234649 missense possibly damaging 0.58
R1491:Psmd9 UTSW 5 123228347 missense probably benign
R1598:Psmd9 UTSW 5 123241917 missense probably damaging 1.00
R2024:Psmd9 UTSW 5 123241862 missense probably damaging 1.00
R3816:Psmd9 UTSW 5 123234590 unclassified probably benign
R3879:Psmd9 UTSW 5 123234590 unclassified probably benign
R3880:Psmd9 UTSW 5 123234590 unclassified probably benign
R8004:Psmd9 UTSW 5 123241935 critical splice donor site probably null
R8143:Psmd9 UTSW 5 123228416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACTGGTACCCACTGCAGAG -3'
(R):5'- AGCAGAAAAGCTTTGCAGTGC -3'

Sequencing Primer
(F):5'- CCCACTGCAGAGGGTAGCTATAAG -3'
(R):5'- AAGCTTTGCAGTGCTCAATG -3'
Posted On2015-04-02