Incidental Mutation 'R3811:Med23'
ID 275198
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Name mediator complex subunit 23
Synonyms X83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission 040767-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3811 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 24869986-24913681 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 24892592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 77 (R77*)
Ref Sequence ENSEMBL: ENSMUSP00000135232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000176502] [ENSMUST00000177232]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000020159
AA Change: R437*
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: R437*

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092646
AA Change: R443*
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: R443*

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175786
Predicted Effect probably null
Transcript: ENSMUST00000176285
AA Change: R77*
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: R77*

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect silent
Transcript: ENSMUST00000176502
SMART Domains Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 95 8.7e-36 PFAM
Pfam:Med23 92 234 3.8e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179967
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
R8975:Med23 UTSW 10 24904436 missense probably benign 0.42
R9131:Med23 UTSW 10 24904381 missense
R9202:Med23 UTSW 10 24904304 missense probably benign 0.12
R9341:Med23 UTSW 10 24912807 missense probably benign
R9342:Med23 UTSW 10 24874571 missense probably benign 0.01
R9343:Med23 UTSW 10 24912807 missense probably benign
R9412:Med23 UTSW 10 24902121 missense probably damaging 1.00
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCAAAGAGCTATTGGGGC -3'
(R):5'- CAGGGTTAACTATCAGCCTACTGG -3'

Sequencing Primer
(F):5'- CTAAGCTAAGATAGGAGTTCTAACGC -3'
(R):5'- GGCCGTGTGGGAGACATC -3'
Posted On 2015-04-02