Incidental Mutation 'R3811:Ilvbl'
ID275200
Institutional Source Beutler Lab
Gene Symbol Ilvbl
Ensembl Gene ENSMUSG00000032763
Gene NameilvB (bacterial acetolactate synthase)-like
Synonyms
MMRRC Submission 040767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R3811 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78574346-78584502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78579035 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 244 (C244Y)
Ref Sequence ENSEMBL: ENSMUSP00000151674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105384] [ENSMUST00000218061] [ENSMUST00000218215] [ENSMUST00000218271] [ENSMUST00000218763] [ENSMUST00000218787] [ENSMUST00000218875] [ENSMUST00000218885] [ENSMUST00000220430]
Predicted Effect probably benign
Transcript: ENSMUST00000105384
AA Change: C244Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101023
Gene: ENSMUSG00000032763
AA Change: C244Y

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:TPP_enzyme_N 52 220 1.4e-53 PFAM
Pfam:TPP_enzyme_M 273 405 2.1e-16 PFAM
Pfam:TPP_enzyme_C 467 618 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218061
Predicted Effect probably benign
Transcript: ENSMUST00000218215
AA Change: C244Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218271
AA Change: C244Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218670
Predicted Effect probably benign
Transcript: ENSMUST00000218763
Predicted Effect probably benign
Transcript: ENSMUST00000218787
Predicted Effect probably benign
Transcript: ENSMUST00000218875
AA Change: C244Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218885
AA Change: C244Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000219588
AA Change: C115Y
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219971
Predicted Effect probably benign
Transcript: ENSMUST00000220430
AA Change: C244Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with several thiamine pyrophosphate-binding proteins identified in bacteria, yeast, and plants. The highest degree of similarity is found with bacterial acetolactate synthases (AHAS), which are enzymes that catalyze the first step in branched-chain amino acid biosynthesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Ilvbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ilvbl APN 10 78583905 missense probably damaging 1.00
IGL00962:Ilvbl APN 10 78583338 missense possibly damaging 0.95
IGL01655:Ilvbl APN 10 78577333 splice site probably benign
IGL01657:Ilvbl APN 10 78576768 missense possibly damaging 0.57
IGL01682:Ilvbl APN 10 78577107 splice site probably benign
IGL01768:Ilvbl APN 10 78583293 missense possibly damaging 0.80
IGL01982:Ilvbl APN 10 78579022 missense probably damaging 1.00
IGL02207:Ilvbl APN 10 78583702 critical splice donor site probably null
IGL02561:Ilvbl APN 10 78577144 missense probably benign 0.01
IGL02985:Ilvbl APN 10 78579067 missense probably benign 0.00
R0398:Ilvbl UTSW 10 78579539 missense probably damaging 0.99
R0557:Ilvbl UTSW 10 78583487 nonsense probably null
R0562:Ilvbl UTSW 10 78583487 missense probably damaging 1.00
R0583:Ilvbl UTSW 10 78583267 missense probably damaging 0.99
R1381:Ilvbl UTSW 10 78576596 missense probably damaging 1.00
R1484:Ilvbl UTSW 10 78576730 missense probably damaging 1.00
R1537:Ilvbl UTSW 10 78579731 missense probably benign 0.31
R1862:Ilvbl UTSW 10 78584124 missense probably benign 0.00
R2474:Ilvbl UTSW 10 78576724 missense probably damaging 1.00
R2876:Ilvbl UTSW 10 78583056 missense probably benign
R3621:Ilvbl UTSW 10 78577180 missense probably damaging 1.00
R4591:Ilvbl UTSW 10 78583305 missense probably benign 0.01
R5040:Ilvbl UTSW 10 78583318 missense probably damaging 1.00
R5449:Ilvbl UTSW 10 78577028 critical splice donor site probably null
R5795:Ilvbl UTSW 10 78577144 missense probably benign 0.01
R5910:Ilvbl UTSW 10 78577113 missense probably benign
R6746:Ilvbl UTSW 10 78577223 missense possibly damaging 0.48
R7019:Ilvbl UTSW 10 78579086 missense probably damaging 0.96
R7223:Ilvbl UTSW 10 78583696 missense probably benign 0.31
R7494:Ilvbl UTSW 10 78579023 missense possibly damaging 0.76
R7576:Ilvbl UTSW 10 78583697 missense possibly damaging 0.45
R7727:Ilvbl UTSW 10 78576666 missense probably benign 0.00
R7777:Ilvbl UTSW 10 78577251 critical splice donor site probably null
R7800:Ilvbl UTSW 10 78583975 missense possibly damaging 0.48
R8082:Ilvbl UTSW 10 78584153 missense probably damaging 0.98
Z1177:Ilvbl UTSW 10 78581124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTTAATGTGTTTCGGGGAAC -3'
(R):5'- ATCATCGTCGGGTTGCCATC -3'

Sequencing Primer
(F):5'- CGGGGAACTGTGTCAAGTTAG -3'
(R):5'- GGTTGCCATCAGCCCACAAG -3'
Posted On2015-04-02