Incidental Mutation 'R3811:Metap2'
ID275201
Institutional Source Beutler Lab
Gene Symbol Metap2
Ensembl Gene ENSMUSG00000036112
Gene Namemethionine aminopeptidase 2
Synonymsp67, 4930584B20Rik, A930035J23Rik, eIF-2-associated p67
MMRRC Submission 040767-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3811 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93858489-93897093 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 93870164 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 252 (L252*)
Ref Sequence ENSEMBL: ENSMUSP00000138083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047910] [ENSMUST00000180688] [ENSMUST00000180840] [ENSMUST00000181091] [ENSMUST00000181217] [ENSMUST00000181470]
Predicted Effect probably null
Transcript: ENSMUST00000047910
AA Change: L242*
SMART Domains Protein: ENSMUSP00000048285
Gene: ENSMUSG00000036112
AA Change: L242*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 167 466 1.2e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180375
AA Change: L215*
Predicted Effect probably null
Transcript: ENSMUST00000180392
AA Change: L99*
Predicted Effect probably benign
Transcript: ENSMUST00000180688
SMART Domains Protein: ENSMUSP00000137652
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 76 107 N/A INTRINSIC
Pfam:Peptidase_M24 166 233 2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180840
AA Change: L242*
SMART Domains Protein: ENSMUSP00000138006
Gene: ENSMUSG00000036112
AA Change: L242*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 167 466 2.8e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000181091
AA Change: L219*
SMART Domains Protein: ENSMUSP00000137904
Gene: ENSMUSG00000036112
AA Change: L219*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 144 443 2.2e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000181217
AA Change: L252*
SMART Domains Protein: ENSMUSP00000138083
Gene: ENSMUSG00000036112
AA Change: L252*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 177 476 2.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181442
Predicted Effect probably benign
Transcript: ENSMUST00000181470
SMART Domains Protein: ENSMUSP00000138050
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
Pfam:Peptidase_M24 1 97 6.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216232
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the methionyl aminopeptidase family. The encoded protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent proteins. Increased expression of this gene is associated with various forms of cancer, and the anti-cancer drugs fumagillin and ovalicin inhibit the protein by irreversibly binding to its active site. Inhibitors of this gene have also been shown to be effective for the treatment of obesity. A pseudogene of this gene is located on chromosome 2. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E8.5, smaller size, failure to gastrulate, reduced cell proliferation and absence of a distinct mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Metap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Metap2 APN 10 93871478 splice site probably benign
IGL02553:Metap2 APN 10 93865449 missense probably damaging 1.00
R0212:Metap2 UTSW 10 93861380 missense probably damaging 1.00
R0749:Metap2 UTSW 10 93879567 missense probably benign 0.43
R1183:Metap2 UTSW 10 93870184 missense probably damaging 1.00
R1459:Metap2 UTSW 10 93868949 missense probably damaging 1.00
R1468:Metap2 UTSW 10 93871483 splice site probably null
R1468:Metap2 UTSW 10 93871483 splice site probably null
R1646:Metap2 UTSW 10 93870197 missense probably damaging 1.00
R3810:Metap2 UTSW 10 93870164 nonsense probably null
R3812:Metap2 UTSW 10 93870164 nonsense probably null
R4174:Metap2 UTSW 10 93879565 missense possibly damaging 0.68
R4801:Metap2 UTSW 10 93868895 missense probably damaging 1.00
R4802:Metap2 UTSW 10 93868895 missense probably damaging 1.00
R4983:Metap2 UTSW 10 93889600 missense possibly damaging 0.86
R5030:Metap2 UTSW 10 93879677 splice site probably null
R5276:Metap2 UTSW 10 93868922 missense possibly damaging 0.93
R5276:Metap2 UTSW 10 93868932 missense probably benign 0.02
R8191:Metap2 UTSW 10 93865405 critical splice donor site probably null
R8311:Metap2 UTSW 10 93861522 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTACAGCTTTAGAGAAGGAGCC -3'
(R):5'- ATGAGCTCCGCATTCAGAAAG -3'

Sequencing Primer
(F):5'- CAGCTTTAGAGAAGGAGCCAAGAAC -3'
(R):5'- TGAGCTCCGCATTCAGAAAGTACTC -3'
Posted On2015-04-02